ID: 1182897098 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:33868002-33868024 |
| Sequence | GCTGCAAGAGATTACAGGGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1182897098_1182897103 | 9 | Left | 1182897098 | 22:33868002-33868024 | CCTACCCTGTAATCTCTTGCAGC | No data | ||
| Right | 1182897103 | 22:33868034-33868056 | GCTCCATTTTCCCACAACCACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1182897098 | Original CRISPR | GCTGCAAGAGATTACAGGGT AGG (reversed) | Intronic | ||