ID: 1182897098

View in Genome Browser
Species Human (GRCh38)
Location 22:33868002-33868024
Sequence GCTGCAAGAGATTACAGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182897098_1182897103 9 Left 1182897098 22:33868002-33868024 CCTACCCTGTAATCTCTTGCAGC 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1182897103 22:33868034-33868056 GCTCCATTTTCCCACAACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182897098 Original CRISPR GCTGCAAGAGATTACAGGGT AGG (reversed) Intronic
901461494 1:9394636-9394658 GCCGAGAGAGATGACAGGGTGGG - Intergenic
903689300 1:25160017-25160039 GCTGCTAGAGCTAACAGGGGAGG - Intergenic
905210362 1:36369823-36369845 GCTGGAAGAGAACACAGTGTGGG + Intronic
905975587 1:42171498-42171520 GCTACAAGAGTTTTCAGAGTAGG + Intergenic
906765901 1:48433113-48433135 GTTGCAAGAGACTGCAGGGAGGG + Intronic
907931716 1:59006995-59007017 TCGGCAAGAGATTAAAGGGTGGG + Intergenic
909345565 1:74581978-74582000 GTTGCAAGAGCTTCCAGGCTTGG + Intronic
909994788 1:82265991-82266013 GGGGCAAGAGATCACAGGGCAGG + Intergenic
911605883 1:99904624-99904646 GCTGCCAGAGAGACCAGGGTTGG - Intronic
913494876 1:119419313-119419335 GCTCAAAGAGATTAGAGTGTGGG - Intronic
916337393 1:163688686-163688708 GCTGGTAGAGAATAGAGGGTTGG - Intergenic
916690135 1:167182193-167182215 GCTGAAAGAGAGGACAGGGCAGG + Intergenic
917862847 1:179164028-179164050 GCTGCCAGGGATTAAAGGGGGGG + Intronic
918176582 1:182051696-182051718 GATGCCAGAGATTTCAGGGGTGG - Intergenic
922423101 1:225472289-225472311 GCTGCAAGAGAGTGCAGGAGGGG - Intergenic
923654262 1:235901641-235901663 GAGGCAAGAGAGCACAGGGTGGG - Intergenic
924269079 1:242313925-242313947 GCAGCAAGAGATGACAGTGAAGG + Intronic
1066442323 10:35450192-35450214 GGTGGAAGAATTTACAGGGTTGG + Intronic
1066715822 10:38284844-38284866 GCAGCAAGAGATGACAGTGAAGG - Intergenic
1067076341 10:43187054-43187076 GTTGCTAGAGGTTAGAGGGTAGG - Intergenic
1067415268 10:46097661-46097683 GCTTCAAGGGGATACAGGGTGGG - Intergenic
1069043877 10:63722541-63722563 GCAGCATGCAATTACAGGGTGGG - Intergenic
1069871281 10:71534766-71534788 GCTGGAAGATATGACAGGTTTGG + Intronic
1070158102 10:73848736-73848758 GCAGCAAGAGCTGACAGGCTGGG + Intronic
1071499824 10:86195367-86195389 GCAGCCACAGGTTACAGGGTGGG - Intronic
1072746394 10:97941990-97942012 TCTGCAAGAGAGTGCTGGGTTGG - Intronic
1075527618 10:123199662-123199684 GCTGCATCAGAATACAAGGTGGG + Intergenic
1077514964 11:2995995-2996017 ACAGCAAGAGATTGCAGGGTAGG + Intergenic
1089673203 11:120071492-120071514 GCTGCAAGGCATACCAGGGTGGG - Intergenic
1091158981 11:133402190-133402212 GCTGGAAGGCATCACAGGGTGGG + Intronic
1094607179 12:31959213-31959235 GCTGCAGGAGATTTCCGCGTCGG + Intergenic
1096489579 12:52006508-52006530 GCTGCAGGAGACTCCAGGGCAGG - Intergenic
1097905712 12:64917499-64917521 GATGACAGAGATTACAGGTTTGG - Intergenic
1100609863 12:96182635-96182657 GCTGCTACACATAACAGGGTGGG - Intergenic
1104616467 12:130273946-130273968 GCTGCCAGAGGTTGCAGGGGAGG - Intergenic
1106694889 13:32162734-32162756 GCAGAAAGAGACTACAGGGCTGG - Intronic
1106902639 13:34370093-34370115 GCTGGAAGACATCACAGAGTTGG - Intergenic
1108434687 13:50390176-50390198 CCTGCAGGAGATTAAAGGGAGGG - Intronic
1112388703 13:98963221-98963243 GTTCCAAGAGATTGAAGGGTGGG - Intronic
1115340081 14:32284363-32284385 GTTGCCAGAGATTTGAGGGTAGG - Intergenic
1116397332 14:44462429-44462451 TCTGCAAGATATTACAGAGTCGG + Intergenic
1118382269 14:65227315-65227337 ACAGTGAGAGATTACAGGGTAGG + Intergenic
1119173265 14:72550554-72550576 GCTGCAGAAGATTACAAGGTTGG - Intronic
1120902260 14:89585897-89585919 GATGCTAGAGATTGCAGGGTTGG + Intronic
1123977817 15:25569641-25569663 GCTCCAAGAGATTACCTGGGGGG + Intergenic
1125421966 15:39512857-39512879 GCAGCAAGAGATCATAGAGTGGG - Intergenic
1128843573 15:70870902-70870924 GCTGCAAGATATTTGAGGGCAGG + Intronic
1135787554 16:25363975-25363997 GCAGCAAGAGCTCAGAGGGTGGG - Intergenic
1137776787 16:51061723-51061745 GTTCCAAGAAATTACAAGGTTGG + Intergenic
1138469698 16:57223963-57223985 GCTGCTAGAGATTTCAGGCCAGG + Intronic
1138595967 16:58029072-58029094 GCTGCCAGAGTTCACAGGGGTGG + Intronic
1138768825 16:59637351-59637373 GGTGCAAGAAATGAAAGGGTGGG + Intergenic
1143474964 17:7197162-7197184 TCTGCCAGAGATGCCAGGGTGGG + Intronic
1148809363 17:50280310-50280332 CCTGTAGGAGATTCCAGGGTGGG - Exonic
1150590951 17:66561878-66561900 GCTGCTAGAGGCTACAGGGAAGG + Intronic
1153659873 18:7317070-7317092 GCGGCAAGAGCTCAGAGGGTGGG + Intergenic
1156106889 18:33674425-33674447 ACTGCAAGTGTTTACTGGGTAGG + Intronic
1161308121 19:3578392-3578414 GCTCCAACAGATGCCAGGGTTGG - Intronic
1162823851 19:13238995-13239017 GCAGCAAGAGATGACAGTGGAGG - Intronic
1165086459 19:33351492-33351514 GCTGCCAGAGGTTTCAGAGTAGG - Intergenic
1165838805 19:38774648-38774670 TCTGCAAGAGAACTCAGGGTTGG + Intergenic
1166644279 19:44519706-44519728 GCAGCAAGAGATGATAGGGCTGG - Intronic
1168547894 19:57268823-57268845 GCTGTAAGAGATTCTAGGCTAGG - Intergenic
926037851 2:9649046-9649068 GCTGCAGCAGAATGCAGGGTTGG + Intergenic
928268898 2:29836736-29836758 TCTACTAGAGATTACATGGTTGG + Intronic
934991928 2:98927783-98927805 GCTGCAAGAAATTCCATTGTAGG - Intronic
935096664 2:99951547-99951569 GGTACAAGAGATGACAGGTTAGG + Intronic
935206565 2:100901585-100901607 GCAGCAGGAGATCAGAGGGTGGG + Intronic
935764206 2:106348863-106348885 GCTGAAAGAGATTACAGAAATGG - Intergenic
938065872 2:128281743-128281765 CCTGAATGAGATGACAGGGTGGG + Intronic
940000747 2:148964444-148964466 GGTGCTGGAGATTAAAGGGTGGG + Intronic
1169035827 20:2451213-2451235 GGAGCAAGAGAATAAAGGGTAGG - Intergenic
1173681851 20:44887507-44887529 TGTACAAAAGATTACAGGGTAGG - Intronic
1175965320 20:62657381-62657403 GCTGCAAGAGTTGGCAGGGGAGG + Intronic
1177214306 21:18108557-18108579 GGTGCAACACATTACAGGATGGG + Intronic
1179009136 21:37540824-37540846 GGTTCAACAGAATACAGGGTGGG - Intergenic
1179222929 21:39425738-39425760 GCTGGAAGACATTACAAGTTGGG - Intronic
1181278880 22:21704304-21704326 GCTGCCAGATATTAGGGGGTAGG + Intronic
1181613371 22:24034757-24034779 GCTGCAAAAGATGACAGGATTGG - Intronic
1181828051 22:25535744-25535766 GCTGCAAAAGGTGAGAGGGTAGG + Intergenic
1182713153 22:32335058-32335080 CCTCCAAGAGATCACAGGGAGGG + Intergenic
1182897098 22:33868002-33868024 GCTGCAAGAGATTACAGGGTAGG - Intronic
949351667 3:3129461-3129483 TCCCCAAGAGATTACAGGCTGGG - Intronic
951869235 3:27341962-27341984 GCTGCATGAGATTGAGGGGTGGG - Intronic
952884339 3:38003304-38003326 GCAACAAGAGGTAACAGGGTTGG + Exonic
953277919 3:41522249-41522271 ACTGCATGAGATTACAGGTTGGG - Intronic
953660331 3:44887252-44887274 CCTGCAACAGCTTGCAGGGTAGG + Intronic
954887602 3:53890154-53890176 GCTACAAAAGTTTAGAGGGTGGG + Intronic
957336641 3:78838551-78838573 TGTGCAAGAGATCACATGGTAGG + Intronic
957941044 3:87004031-87004053 GTTGCATTAGATTACAGGGGAGG + Intergenic
960350949 3:116592041-116592063 TCTGTAAGAGATTATAGAGTGGG + Intronic
962391358 3:134975411-134975433 GCTGTAAGAGAGTGAAGGGTAGG + Intronic
962467322 3:135672929-135672951 GCTGGAAGATATTGCAGGGGTGG - Intergenic
966261224 3:177981730-177981752 GGTGCAAGAGATGACTGGGTAGG + Intergenic
969357982 4:6641964-6641986 GCTGCAAGAGCTTACAATCTAGG - Exonic
970156021 4:13142476-13142498 GCTCCAAGAGGTTACAAGGTAGG + Intergenic
971483053 4:27131390-27131412 GCTGCCAGAGTTTACAGGCTGGG - Intergenic
974973255 4:68857899-68857921 CCTTCAAGATATTACAGGTTTGG - Intergenic
980974345 4:139596743-139596765 GCAGCATGAGATGACTGGGTGGG - Intronic
982461231 4:155671278-155671300 GTGGCAAGAGATTTAAGGGTTGG - Intronic
983577095 4:169271263-169271285 GCTGCAAGAGCCTAGAGGATGGG + Intergenic
984865006 4:184273730-184273752 GCTGCAAGAGCTTGCTGGCTTGG - Intergenic
985198149 4:187455379-187455401 GCTGCATGAGAATCCAGGGGAGG - Intergenic
985486134 5:151731-151753 CCTGCAAGAACTTACGGGGTAGG - Intronic
986407118 5:7437217-7437239 GCTGAAAAAGATCACAGGGGAGG - Intronic
988304069 5:29471481-29471503 ACTGTAAGACATTACAGGGAAGG + Intergenic
989511558 5:42293831-42293853 GTGGCAGGAGATTGCAGGGTTGG + Intergenic
991146405 5:63310490-63310512 GTTGCCAGAGATTAGAGGGGAGG + Intergenic
991778397 5:70108331-70108353 ACTTCAAGAGATTCCAGGGAAGG + Intergenic
991857687 5:70983798-70983820 ACTTCAAGAGATTCCAGGGAAGG + Exonic
991870846 5:71108684-71108706 ACTTCAAGAGATTCCAGGGAAGG + Intergenic
999848927 5:155516415-155516437 GCTGCTTGAGATTACACAGTTGG + Intergenic
1000154017 5:158533139-158533161 GCTTCAAGAGATCACAGTGAGGG + Intergenic
1000227613 5:159281220-159281242 ACAGCAGGAAATTACAGGGTTGG - Intronic
1000889101 5:166783260-166783282 GATGCAAGAAATTAAAGTGTGGG - Intergenic
1001749179 5:174115831-174115853 GCTTCCAGATATTACAGGGTAGG - Intronic
1002940606 6:1712079-1712101 ACTGCAAGAGATTGGAGGTTTGG + Intronic
1006110719 6:31743332-31743354 GCTGCAGGTTATTAAAGGGTAGG - Intronic
1007803753 6:44421006-44421028 ACGGCAAGGGATTACAGTGTGGG - Intronic
1011462189 6:87616292-87616314 GCTGAAAGAGATTAAAAGGGAGG - Exonic
1012564069 6:100623602-100623624 CCTGCATGAGATTACAAAGTGGG + Intronic
1013711241 6:112902116-112902138 GCTGTAATAGAATTCAGGGTTGG - Intergenic
1017583202 6:155889923-155889945 GCTGTAAGACACTCCAGGGTGGG - Intergenic
1018040337 6:159916045-159916067 CCTGCAAGTGACTACAGGGGTGG + Exonic
1023487105 7:40699059-40699081 GGAACAAGAGGTTACAGGGTGGG + Intronic
1025625199 7:63215206-63215228 TCTTCAAGAGATTTCAGGCTTGG + Intergenic
1026000788 7:66557972-66557994 GCTGCAGCAGATTGCGGGGTGGG + Intergenic
1026974182 7:74486553-74486575 GCTGCAAGAGAGTATAGGAATGG + Intronic
1030060550 7:105617795-105617817 GCTGAAAGAGAATACTGTGTTGG + Intronic
1030662074 7:112230461-112230483 GCTGCAAGAGATTAAAGTAGTGG - Intronic
1032310496 7:130781715-130781737 GATGCTAGAGAAAACAGGGTTGG + Intergenic
1034047672 7:147947140-147947162 GCTCCAAGAGATTACCTGGGAGG - Intronic
1037650388 8:20832494-20832516 GCTGTAAGATATTCCAGGGAGGG + Intergenic
1039225625 8:35385174-35385196 GCTGCCAGAGAGTAAAGGGATGG - Intronic
1043590683 8:81830271-81830293 GCTGAAAGAAATCACAGGGCCGG + Intronic
1044852294 8:96440886-96440908 GCTGCTAGAGATCACAGGCTAGG - Intergenic
1044918045 8:97137034-97137056 ACTGCAGGAGATACCAGGGTGGG - Intronic
1048342861 8:133554305-133554327 GCTGCAAGGGAGCATAGGGTTGG - Intronic
1053515762 9:38729473-38729495 GAGGCAGGAGATTACAGGCTTGG - Intergenic
1055506950 9:76957788-76957810 CCCTCAAGAGATTACAGGCTAGG + Intergenic
1189487005 X:41442158-41442180 GCTGGAAGGGATGCCAGGGTGGG - Intergenic
1190156954 X:48001835-48001857 GCTGCCTGAGGTTACAGGTTGGG + Intronic
1196155114 X:112419915-112419937 GCTTCCCTAGATTACAGGGTAGG + Intergenic
1197112256 X:122790096-122790118 GCTGAAAGTGTTTCCAGGGTTGG + Intergenic