ID: 1182897099

View in Genome Browser
Species Human (GRCh38)
Location 22:33868006-33868028
Sequence GTGTGCTGCAAGAGATTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 5, 3: 7, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182897099_1182897103 5 Left 1182897099 22:33868006-33868028 CCCTGTAATCTCTTGCAGCACAC 0: 1
1: 0
2: 5
3: 7
4: 106
Right 1182897103 22:33868034-33868056 GCTCCATTTTCCCACAACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182897099 Original CRISPR GTGTGCTGCAAGAGATTACA GGG (reversed) Intronic
900004908 1:38724-38746 GTCTGTTGCAAGAGATTACAAGG + Intergenic
902336025 1:15755465-15755487 TTGTCCTGCAAGAGAATCCAAGG - Intergenic
902821848 1:18948292-18948314 CTGAGGTGCAAGAGATTAAATGG + Intronic
903396596 1:23006337-23006359 GTGTGCTGCACCAGAACACAGGG - Intergenic
907762579 1:57376041-57376063 ATGTGCTGCAAGAGATTCCATGG + Intronic
911069043 1:93817630-93817652 GAATGCTGCCAGAGATGACATGG - Intronic
911413314 1:97538759-97538781 TTGTGCTTCATGAGCTTACAGGG + Intronic
911441666 1:97934657-97934679 GTGAGCAGCCAGAGATTTCAGGG - Intergenic
911840642 1:102676797-102676819 GGGAGCTGCAAGAGATTTGATGG + Intergenic
916414474 1:164579683-164579705 GTGTGCTCCAAGTGATTTGAAGG + Intronic
916843180 1:168621394-168621416 GTGTGCTGCAAGAAAAAATAAGG - Intergenic
923212140 1:231813111-231813133 GTGGGTTGCAAGGGATTAGAGGG + Intronic
923864597 1:237926645-237926667 ATTTTCTGGAAGAGATTACAGGG + Intergenic
1065974493 10:30830503-30830525 GTGTGTTACCTGAGATTACAGGG - Intronic
1066224459 10:33368689-33368711 GTGGTCTGCAAGAGCCTACAAGG - Intergenic
1067226465 10:44379467-44379489 TTGGGCTGCATGAGATTACCTGG - Intronic
1068992772 10:63166825-63166847 GGGTGTTGTAACAGATTACATGG + Intergenic
1070869640 10:79739289-79739311 GTTTTCTGCAAAAGAGTACATGG + Intergenic
1071636558 10:87261498-87261520 GTTTTCTGCAAAAGAGTACATGG + Intergenic
1071658686 10:87476451-87476473 GTTTTCTGCAAAAGAGTACATGG - Intergenic
1078627460 11:12970680-12970702 CTGGGGTGCAAGAGACTACAGGG - Intergenic
1079576123 11:22004850-22004872 GTGTGCTGATAGAGATTATAGGG - Intergenic
1082089438 11:48077362-48077384 GTGGGCTGAAAGAGAAGACAGGG + Intronic
1086137165 11:83453442-83453464 GTGTGCTGCAACAGAGGAAAGGG + Intergenic
1086496468 11:87409485-87409507 GTGTTCTTGAAGAGATTTCAGGG - Intergenic
1086609424 11:88736728-88736750 TTTTCCTGCAAGGGATTACATGG - Intronic
1086989714 11:93289630-93289652 GTGAGTTGTAAGAGATTACTTGG - Intergenic
1091378319 12:40774-40796 GTCTGTTGCAAGAGATTATAAGG + Intergenic
1092515351 12:9205896-9205918 GTGTGCTGGAGCAGACTACATGG - Intronic
1093213829 12:16339455-16339477 ATGTGCTGCAAGACATCACTTGG - Intergenic
1098369406 12:69740021-69740043 TTCCACTGCAAGAGATTACAAGG - Intronic
1099000265 12:77170915-77170937 GTGTGCTGCAGGAGGTGACTAGG + Intergenic
1099387779 12:82037861-82037883 GTGTGCTACATGAGATAGCATGG + Intergenic
1101127223 12:101648961-101648983 ATGTGCTTCAAGAGCCTACATGG + Intronic
1108521448 13:51250574-51250596 GTGTTCCGCCAGAGATCACAGGG + Intronic
1118993004 14:70812495-70812517 GTGTGAATCAAGTGATTACAGGG - Intergenic
1119173266 14:72550558-72550580 TTTTGCTGCAGAAGATTACAAGG - Intronic
1119243553 14:73083509-73083531 TTGAGCTGGAAGAGAGTACAAGG + Exonic
1119776828 14:77254139-77254161 GTGTGGGGCAAGAGTTTTCAAGG + Intronic
1122525934 14:102384372-102384394 GTGTGTATCAAGAGATCACATGG + Intronic
1124827433 15:33112752-33112774 CTGTTCTGCTAGAGATCACATGG + Intronic
1125315758 15:38429497-38429519 GTGTGATGCTAGATATTAAAAGG - Intergenic
1130827495 15:87564724-87564746 GTGTCCTGCAACAGCTTCCATGG + Intergenic
1131213392 15:90517093-90517115 GGTGGCTGCAACAGATTACAGGG + Intergenic
1132448601 15:101952220-101952242 GTCTGTTGCAAGAGATTACAAGG - Intergenic
1134157864 16:11858632-11858654 GTGTTGGGCATGAGATTACAGGG + Intergenic
1139153037 16:64407570-64407592 GTGTGCTGCTAGTGATGACCAGG + Intergenic
1140121180 16:72084161-72084183 GTGTGATGCAACAGCCTACAAGG - Intronic
1140563813 16:76016091-76016113 GTGAGCTTCAAGAGAACACAAGG - Intergenic
1144670582 17:17130544-17130566 GTATCCTGCTAGAGATCACACGG - Intronic
1144788714 17:17845856-17845878 ATGTGCTGCCAGAGAGGACAGGG + Intronic
1145021381 17:19434143-19434165 GTGTGCTGCAGGACAGGACATGG + Intergenic
1152773299 17:82184199-82184221 GTGTGCTGCAGGAGCTTAGCTGG - Intronic
1155558443 18:27048621-27048643 GTGTGCTCCTAGAGATGACTGGG + Intronic
1157201770 18:45665464-45665486 ATCTGCTTCAAGAGATTACATGG + Intronic
1157423942 18:47569334-47569356 GGGGGCTGGAAGAGATCACAGGG - Intergenic
1159116823 18:64123942-64123964 GTGTGTGCCAAGAGATTACGTGG - Intergenic
1160636661 19:80333-80355 GTCTGTTGCAAGAGATTACAAGG + Intergenic
1160911510 19:1476004-1476026 GTGTGCTCCAGGAGGTTGCACGG - Intronic
1167615365 19:50530072-50530094 GTGCGCTGCAAGGCATTAAAAGG - Intronic
925114047 2:1363372-1363394 ATGTGCTATAAGAGATTATAGGG - Intronic
929146713 2:38712841-38712863 GTGCCCTGATAGAGATTACAGGG + Intronic
929194127 2:39167253-39167275 GTGTGCCTCAGGAGATCACAAGG + Intergenic
930428022 2:51235443-51235465 GTTTGGGGCTAGAGATTACAAGG - Intergenic
932374922 2:71227080-71227102 GTGTGCAGTAAGAGATAACCTGG - Exonic
933889377 2:86752914-86752936 GTTTACTGCAGGAAATTACATGG - Intronic
933976705 2:87517826-87517848 GTGTGCTGCTAGAGCTGTCAGGG - Intergenic
936317112 2:111432978-111433000 GTGTGCTGCTAGAGCTGTCAGGG + Intergenic
936564821 2:113574708-113574730 GTCTGTTGCAAGAGATTATAAGG - Intergenic
944974811 2:205037792-205037814 TAGTGATGGAAGAGATTACAGGG + Intronic
945176594 2:207049803-207049825 TTGTGCTGCAAGAGGTCAAAGGG - Intergenic
1174681530 20:52413623-52413645 GTGTGTGCAAAGAGATTACACGG + Intergenic
1174961677 20:55164693-55164715 GTGTGTGCAAAGAGATTACATGG + Intergenic
1175485125 20:59340316-59340338 GTGTGTTGCAAGAGAAGAGATGG + Intergenic
1182897099 22:33868006-33868028 GTGTGCTGCAAGAGATTACAGGG - Intronic
955478822 3:59368289-59368311 GTGTGTTGCCAGAGTTTCCATGG + Intergenic
968718580 4:2180779-2180801 GTCAGTTGCAAGAGATTATAGGG - Intronic
970694667 4:18663477-18663499 GTGAAATGGAAGAGATTACAAGG + Intergenic
970809522 4:20075787-20075809 CTGTGCTGCAAGAGATTTATGGG - Intergenic
974551779 4:63384160-63384182 GTAAGCTTCAATAGATTACAAGG - Intergenic
979748220 4:124243698-124243720 GAGTGCTGCAACAGAATGCATGG - Intergenic
979939271 4:126739578-126739600 CTGTTATCCAAGAGATTACAAGG - Intergenic
981877656 4:149567769-149567791 GAGGGCTGCAAGACATGACAAGG + Intergenic
982411431 4:155081789-155081811 GTGAGCAGCAAGAGAGTACCTGG + Intergenic
986111013 5:4717641-4717663 TTCTGCTGCAAGACATTGCAAGG - Intergenic
986348591 5:6856561-6856583 TTGTGCAGCAAGAGAATAAATGG + Intergenic
989973080 5:50547893-50547915 GTGTACCGCAAGAAATTTCAGGG - Intergenic
990599664 5:57344991-57345013 GAGTGCTACAAAAAATTACAGGG - Intergenic
991138678 5:63213865-63213887 GTGTGATGTAAGATATTATAGGG + Intergenic
1004016362 6:11735679-11735701 GTGTGCTGCAGGAGAGAAAATGG + Exonic
1006143083 6:31942770-31942792 GTGTGCTGCAGGAGAGTGAAGGG + Intronic
1006314372 6:33281346-33281368 GTGTGCTGCATGTGTGTACAGGG - Intronic
1009214584 6:60905858-60905880 GTTTCCTGCAACAGAATACAGGG + Intergenic
1014921771 6:127221879-127221901 GTGAACTGCAAGAGATTTTATGG - Intergenic
1024806272 7:53144657-53144679 GTGTTCTGCAAGAGAAGAGAAGG - Intergenic
1024838502 7:53554771-53554793 GAGTGCTGAAAGAGATGTCAAGG - Intergenic
1029214082 7:98932912-98932934 GTGTACTTCAAGAGAGTAGAGGG + Intronic
1030363349 7:108618745-108618767 GTGTTCTACAAGATCTTACAAGG - Intergenic
1032157916 7:129485025-129485047 ATGTGCTGGAGGAGATTCCAGGG + Intronic
1032370650 7:131347438-131347460 GTATGCTGCAAGAGCATGCACGG + Intronic
1032450534 7:132026593-132026615 TTGTGCTGCAAAAGTTTTCAGGG - Intergenic
1033426718 7:141251396-141251418 GTGTGATGCAAGACAGTACTAGG + Intronic
1037687529 8:21155908-21155930 GTGTGGTGGCAGAGATTATATGG + Intergenic
1039425305 8:37480233-37480255 ATGTGCTACAAGGGAGTACAGGG - Intergenic
1043383644 8:79728310-79728332 TTGTTCTGCAGGAGATTACAGGG - Intergenic
1045465261 8:102463713-102463735 GTGTGCAGTACAAGATTACATGG + Intergenic
1049887603 9:38506-38528 GTCTGTTGCAAGAGATTACAAGG + Intergenic
1052457527 9:28719425-28719447 CAGTGCTGCAATAGATTACAGGG - Intergenic
1052847135 9:33346762-33346784 CTGTGCTGCAAGAGATGAGATGG + Intronic
1057822012 9:98339786-98339808 GTGAGCTCCATGAGAATACAGGG - Intronic
1059575688 9:115485831-115485853 GTGTGCTGAGAGAGAATACTGGG - Intergenic
1188495961 X:30783230-30783252 GGGTGCTGCATCAGAATACAAGG - Intergenic
1189886831 X:45555095-45555117 GTGTGCTGGCAGGGATTAGAGGG + Intergenic
1190991158 X:55551998-55552020 TTGTGCTGCAAGATATTTAATGG + Intergenic
1195860930 X:109382031-109382053 GTCTGCTGAAAGAGTTTACCTGG - Intronic
1198624397 X:138553348-138553370 GAGTGCTGCTAGAGCTGACATGG + Intergenic
1199902649 X:152192054-152192076 GTGTGCTGCTAGTGCTTAGATGG + Intronic
1199967701 X:152833624-152833646 GTGTCCTGAAAGACATTCCATGG - Intronic
1200936471 Y:8742738-8742760 GTGGGCTGCCAGGGATTTCAGGG - Intergenic