ID: 1182897100

View in Genome Browser
Species Human (GRCh38)
Location 22:33868007-33868029
Sequence AGTGTGCTGCAAGAGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182897100_1182897103 4 Left 1182897100 22:33868007-33868029 CCTGTAATCTCTTGCAGCACACT No data
Right 1182897103 22:33868034-33868056 GCTCCATTTTCCCACAACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182897100 Original CRISPR AGTGTGCTGCAAGAGATTAC AGG (reversed) Intronic