ID: 1182897100

View in Genome Browser
Species Human (GRCh38)
Location 22:33868007-33868029
Sequence AGTGTGCTGCAAGAGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182897100_1182897103 4 Left 1182897100 22:33868007-33868029 CCTGTAATCTCTTGCAGCACACT 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1182897103 22:33868034-33868056 GCTCCATTTTCCCACAACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182897100 Original CRISPR AGTGTGCTGCAAGAGATTAC AGG (reversed) Intronic
906138048 1:43514289-43514311 AGACTACTGCAAGAGATTAGAGG - Intergenic
908429579 1:64042827-64042849 AGTGTGCTGAAAGTGAATGCAGG + Intronic
909288988 1:73858320-73858342 AGGGTGTTGGAAGAGAATACAGG + Intergenic
910214057 1:84824403-84824425 ATTGTGCTGCAAGAGATTCTAGG - Intronic
917701742 1:177588524-177588546 AATATGATGCCAGAGATTACAGG + Intergenic
918863759 1:189867645-189867667 AGTGTGCTGAAAGTGATGAAAGG + Intergenic
920346383 1:205308372-205308394 TATGTGCTGCAAGAAATCACGGG + Intronic
921053936 1:211530095-211530117 AGTGCTCTGAAAGAGATTCCTGG - Intergenic
922344690 1:224686674-224686696 ATTGTTCTGCCAGAGAATACAGG - Intronic
923212139 1:231813110-231813132 AGTGGGTTGCAAGGGATTAGAGG + Intronic
1064004632 10:11690214-11690236 AGTGTGCGGCGAGAGATTAGCGG - Intergenic
1066508067 10:36066034-36066056 AGGGAGCTGAAGGAGATTACTGG + Intergenic
1068153573 10:53166809-53166831 AGTGTGTTGCAGGAGAGTATTGG - Intergenic
1068293017 10:55030434-55030456 AATGAGCTGCAAAAGATTCCTGG + Intronic
1077812646 11:5654087-5654109 AGTGAGATGCAAGACAATACAGG - Intergenic
1078826160 11:14932273-14932295 AATGTGCTGCCAGTGATGACTGG + Intronic
1079576124 11:22004851-22004873 TGTGTGCTGATAGAGATTATAGG - Intergenic
1081883617 11:46475761-46475783 AGTATGCGACAAGAAATTACGGG - Intronic
1081919089 11:46756102-46756124 AGTGTACTGCAACAGAACACTGG - Intronic
1081970473 11:47194906-47194928 AGTGTGCTGGAAGAGGATAGTGG + Intergenic
1082196083 11:49307906-49307928 ACTGTGCTGAAAGACTTTACAGG + Intergenic
1089207206 11:116773682-116773704 AGTTTCCTTCAAGAGATAACTGG - Intergenic
1089895238 11:121924078-121924100 AGTTTGTTCCATGAGATTACAGG + Intergenic
1090930917 11:131297447-131297469 AGAGGGCTGCAAGAGATAAAAGG - Intergenic
1094794031 12:33950195-33950217 AGTGGACTACAAGAGAATACAGG - Intergenic
1095289372 12:40459765-40459787 AGTGTCCAGCAACAGATGACTGG - Intronic
1103252518 12:119512514-119512536 AGTGTGCTGCAGGAGTCCACAGG + Intronic
1104036314 12:125099645-125099667 AGTGTTCTACAAGGGATAACTGG + Intronic
1108068983 13:46607990-46608012 AGTTTGCAGCCAGAGTTTACCGG + Intronic
1108330780 13:49380138-49380160 AGTGTGGTTTAAAAGATTACTGG - Intronic
1110190041 13:72720044-72720066 AAAGTGCTGGAAGAGAATACTGG - Intronic
1110330198 13:74263353-74263375 TGTATGCAGCAAGAGATTAAAGG + Intergenic
1110780502 13:79459753-79459775 AGTGTGTTGCAGGAGAGTAGAGG - Intergenic
1113074696 13:106455873-106455895 ATTGTGTTGCAATAGACTACAGG + Intergenic
1115956447 14:38785778-38785800 AGTGGGCTTCTAGAAATTACTGG - Intergenic
1118993005 14:70812496-70812518 AGTGTGAATCAAGTGATTACAGG - Intergenic
1121873550 14:97430875-97430897 AGTGTTCTGCAAGACCTTCCAGG + Intergenic
1122951285 14:105046608-105046630 AGAGTGCTGGGAGGGATTACAGG - Intergenic
1125787365 15:42332475-42332497 ACTGTGTAGCAAGACATTACAGG + Intronic
1128464426 15:67897855-67897877 TGTGTGCAGAAAGAGATTTCTGG + Intergenic
1131891163 15:96972918-96972940 AGTGAGCTGCAAAAGTTTAATGG + Intergenic
1134157863 16:11858631-11858653 AGTGTTGGGCATGAGATTACAGG + Intergenic
1135475787 16:22773416-22773438 AGTGTCCTTCAATAGATGACTGG + Intergenic
1148208159 17:45792450-45792472 AGTGAGGAGCAAGAGATTAGGGG - Intronic
1155558442 18:27048620-27048642 AGTGTGCTCCTAGAGATGACTGG + Intronic
1163268980 19:16238218-16238240 AGAGTTCTGCAAGAGAATTCTGG - Intronic
1164919345 19:32077228-32077250 AGTGTCCTGAATGAGATCACAGG + Intergenic
926308652 2:11658717-11658739 AGTGGGCTGCAAGAGAAACCCGG + Exonic
926824652 2:16892330-16892352 AATGTGCTGCCAGTGATGACAGG - Intergenic
927403218 2:22738117-22738139 AATGTGCTGCATGAGATTTTAGG - Intergenic
928899941 2:36306589-36306611 AGTATGCAACAAGATATTACTGG + Intergenic
929168670 2:38908974-38908996 AGTCTGCTGCATGAGAATTCAGG + Intronic
929235939 2:39605643-39605665 AGAGTGCTGCAATTGATTAGTGG + Intergenic
930126577 2:47802756-47802778 AGTGTGCTGCATTTGGTTACTGG + Intronic
930885112 2:56316243-56316265 TGTGTCCTGCCAGAGATTAATGG - Intronic
933095476 2:78173304-78173326 AGTGTCCAGCAAGAGATGAATGG - Intergenic
937749579 2:125458848-125458870 AATGTGCAGGCAGAGATTACAGG - Intergenic
939837467 2:147148703-147148725 ATTCTGATGCAAGAGATTCCTGG - Intergenic
942206488 2:173624792-173624814 AGTGTCCTGCCAGAGTTTGCTGG + Intergenic
945773548 2:214076999-214077021 AGTGTGCAGCATGAGAATAGAGG + Intronic
946497695 2:220212340-220212362 AGAGTGCTGCAGGAGACAACAGG - Intergenic
1169562528 20:6817500-6817522 AGAGTGCTGCTTGGGATTACCGG - Intergenic
1170911473 20:20574794-20574816 ACTGAGCTGCGAGAGATTAGAGG - Intronic
1178226664 21:30726962-30726984 ACTGTGCTGAAACAGATTTCTGG - Intergenic
1178681690 21:34677712-34677734 AGTCTGCTGCAAGAGTTGTCAGG - Intronic
1179323816 21:40319813-40319835 AGTGGGCACCAAGAGATTAAAGG + Intronic
1182161934 22:28131417-28131439 AGTGTGTTGCCAGTGATTTCTGG - Intronic
1182897100 22:33868007-33868029 AGTGTGCTGCAAGAGATTACAGG - Intronic
1183878011 22:40800839-40800861 AGAGTGCTGGAATTGATTACAGG - Intronic
950484092 3:13262662-13262684 ACTGTGCAGCAACAGATGACCGG + Intergenic
957666201 3:83231797-83231819 AATGTGTTGGAAGAAATTACAGG - Intergenic
964205624 3:154171767-154171789 ATGGTGCTGAAAGAGATTATTGG + Intronic
967581058 3:191155431-191155453 AGTGAGCTACAAGAGAACACAGG - Intergenic
970425991 4:15946906-15946928 ATTGTGCTACAGGAGATTATAGG - Intergenic
970809523 4:20075788-20075810 TCTGTGCTGCAAGAGATTTATGG - Intergenic
971495513 4:27260110-27260132 ACTGTTCTGCAAGAGATGCCTGG + Intergenic
977179748 4:93858463-93858485 AGTGAGATACAAGAGAATACAGG + Intergenic
977334414 4:95678177-95678199 AGTGTCATGCATGAGAATACAGG - Intergenic
978050302 4:104190585-104190607 AGTCTGCTGTAGGAGATTACAGG - Intergenic
983605179 4:169574947-169574969 AGTTTTCTGGAAGAGATTACAGG + Intronic
984865007 4:184273735-184273757 TCTGTGCTGCAAGAGCTTGCTGG - Intergenic
990704287 5:58510559-58510581 ACTGGGCTCCAAGAGTTTACAGG - Intergenic
990922801 5:60986245-60986267 AGTGTCCATCAAGAGATGACTGG + Intronic
991138677 5:63213864-63213886 AGTGTGATGTAAGATATTATAGG + Intergenic
996340504 5:122433696-122433718 AGTGTCCTGAAAATGATTACTGG + Intronic
997143452 5:131407221-131407243 AGAGAGCTGCAAGAGGTGACTGG + Intergenic
997437521 5:133885800-133885822 AGTCTGCCTCAAGAGATCACTGG - Intergenic
997644659 5:135473558-135473580 AGTGTCCTGAAAGAGAGAACTGG + Intergenic
1000810137 5:165851261-165851283 TGTGTACTGCTAGAGGTTACGGG + Intergenic
1004175296 6:13334673-13334695 AGTGTACAGCAAGAGATTAATGG - Intergenic
1004256582 6:14069941-14069963 ATTGTGCCGCCACAGATTACGGG - Intergenic
1004919142 6:20359671-20359693 AGTTTGGTGAAAGAAATTACAGG - Intergenic
1005116976 6:22349682-22349704 ACTATGATGCAAGAGACTACAGG - Intergenic
1005305360 6:24508406-24508428 AGTGGGCTGGATGAGATTAGAGG - Intronic
1005596812 6:27387451-27387473 AGTGTTCAACAAGAGATTAATGG + Intronic
1009214583 6:60905857-60905879 AGTTTCCTGCAACAGAATACAGG + Intergenic
1012776420 6:103499288-103499310 ACAGTCCTGTAAGAGATTACCGG - Intergenic
1012913484 6:105142863-105142885 AAAGTGCTGGAAGGGATTACAGG + Intergenic
1015661230 6:135575861-135575883 AGTGTGCTTCAATAAATGACTGG - Intergenic
1016379038 6:143454477-143454499 AATGTGAAGCCAGAGATTACAGG - Intronic
1020371334 7:7435159-7435181 AATGTGCTGCTAGAGTTTATAGG - Intronic
1021202983 7:17746280-17746302 AGTGTGGTAAAAGAGATTATGGG - Intergenic
1028226066 7:88254374-88254396 AGTGAGATGCAAGGGAATACAGG - Intergenic
1029214081 7:98932911-98932933 AGTGTACTTCAAGAGAGTAGAGG + Intronic
1034585488 7:152088181-152088203 AGTGTGATACAAGTGATTATAGG + Intronic
1040646458 8:49402599-49402621 ATTGTGCTCCAGGAGATCACTGG + Intergenic
1041410512 8:57548906-57548928 AGTGTGCTTCATGACCTTACAGG - Intergenic
1043383645 8:79728311-79728333 TTTGTTCTGCAGGAGATTACAGG - Intergenic
1043623645 8:82228435-82228457 AGTGAGATACAAGAGACTACTGG + Intergenic
1045793561 8:106015517-106015539 GGTGTCCAGCAAAAGATTACTGG + Intergenic
1046721495 8:117624544-117624566 ATTTTTCTGCAAAAGATTACTGG - Intergenic
1048600295 8:135912730-135912752 AGTATGCTGCTCCAGATTACTGG + Intergenic
1052457528 9:28719426-28719448 GCAGTGCTGCAATAGATTACAGG - Intergenic
1052686374 9:31763419-31763441 AGTGAGATACAAGAGAATACAGG - Intergenic
1055675789 9:78659029-78659051 ACTGTGCTGAAAGAAATCACAGG - Intergenic
1059575689 9:115485832-115485854 AGTGTGCTGAGAGAGAATACTGG - Intergenic
1188773637 X:34186287-34186309 AGTGTCCCGCAATAGATGACTGG - Intergenic
1189096527 X:38146170-38146192 AGTGTGCATCAAGAGATGATTGG + Intronic
1189904811 X:45746984-45747006 AGTGTCCTGAGAGAGATTATTGG - Intergenic
1191611550 X:63120629-63120651 AGTGTCCATCAAGAGATAACTGG + Intergenic
1194703885 X:97150704-97150726 ACTGTAGTGCAAGAGAGTACAGG - Intronic
1196261001 X:113581554-113581576 TGTCTGAGGCAAGAGATTACAGG - Intergenic
1199417948 X:147608176-147608198 TGGGTGCTGCAAGAAATCACAGG - Intergenic
1201512282 Y:14778212-14778234 GGTGTTCTGCCAGAGATTCCAGG - Intronic