ID: 1182897103

View in Genome Browser
Species Human (GRCh38)
Location 22:33868034-33868056
Sequence GCTCCATTTTCCCACAACCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182897095_1182897103 28 Left 1182897095 22:33867983-33868005 CCAAACCGGATCCAAGCAGCCTA No data
Right 1182897103 22:33868034-33868056 GCTCCATTTTCCCACAACCACGG No data
1182897100_1182897103 4 Left 1182897100 22:33868007-33868029 CCTGTAATCTCTTGCAGCACACT 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1182897103 22:33868034-33868056 GCTCCATTTTCCCACAACCACGG No data
1182897097_1182897103 17 Left 1182897097 22:33867994-33868016 CCAAGCAGCCTACCCTGTAATCT 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1182897103 22:33868034-33868056 GCTCCATTTTCCCACAACCACGG No data
1182897098_1182897103 9 Left 1182897098 22:33868002-33868024 CCTACCCTGTAATCTCTTGCAGC 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1182897103 22:33868034-33868056 GCTCCATTTTCCCACAACCACGG No data
1182897096_1182897103 23 Left 1182897096 22:33867988-33868010 CCGGATCCAAGCAGCCTACCCTG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 1182897103 22:33868034-33868056 GCTCCATTTTCCCACAACCACGG No data
1182897099_1182897103 5 Left 1182897099 22:33868006-33868028 CCCTGTAATCTCTTGCAGCACAC 0: 1
1: 0
2: 5
3: 7
4: 106
Right 1182897103 22:33868034-33868056 GCTCCATTTTCCCACAACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182897103 Original CRISPR GCTCCATTTTCCCACAACCA CGG Intronic
No off target data available for this crispr