ID: 1182897187

View in Genome Browser
Species Human (GRCh38)
Location 22:33868629-33868651
Sequence GGGAGGAATCTGCCTGGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182897187 Original CRISPR GGGAGGAATCTGCCTGGTTA GGG (reversed) Intronic
900232326 1:1566398-1566420 TGAAGGAATCTGCCTGGCTCAGG + Intronic
900271736 1:1793685-1793707 AGGAGGTGTCTGTCTGGTTAAGG - Intronic
900478330 1:2886657-2886679 GGGAGGGAGCTGCCTGGGTAGGG + Intergenic
901081512 1:6586585-6586607 GGGAAGAGTCTGCCTGGGGAGGG - Intronic
901915535 1:12496772-12496794 CGGAGGAATCTGCTTTGTTATGG - Intronic
903647300 1:24903034-24903056 GAGAGGAACCTGCCTGGGCAGGG - Intronic
904306928 1:29596000-29596022 AAGAGGAATGTGACTGGTTAAGG + Intergenic
904609049 1:31715178-31715200 GAGAGGAAGCTGCCAGGTTCTGG + Intergenic
906264559 1:44418233-44418255 GGGAGGGTTCTGCCTGGAGAAGG + Intronic
911243681 1:95493178-95493200 GGGCTGAATTTGCCTGGTGAAGG - Intergenic
913406963 1:118504944-118504966 CCCAGGAATCTGCCTGGTAATGG + Intergenic
915916367 1:159943279-159943301 GGGAGGAATAGGGCTGGTTCTGG - Intronic
915979914 1:160413930-160413952 GGGAGGAAGCAGCCTTGTGAGGG - Intronic
917079764 1:171245628-171245650 GGGAGGAATGTGACTCGTTCTGG - Intergenic
918053599 1:180998281-180998303 TGGAGGAATCTGCCTCATCAGGG - Intronic
922083081 1:222317032-222317054 GGGAGAAATCTGCCCAGTGACGG - Intergenic
922536932 1:226388121-226388143 GGGATGAATCTTTCTGGTCAAGG + Intronic
1062995263 10:1859548-1859570 GGGAGGCATTTGGCTGTTTATGG - Intergenic
1064927164 10:20582008-20582030 GAGAAGAATCTGGCTGGTGATGG + Intergenic
1065906615 10:30259480-30259502 GGCAGGATTCTGTCTGGTTTTGG - Intergenic
1067084445 10:43230402-43230424 AGAAGGAATCTGCCAGGTGATGG + Intronic
1071626076 10:87171978-87172000 TGGAGCAATCTGCTTTGTTACGG - Intronic
1072240733 10:93493314-93493336 GGAAGGAGTCTGCCTGGTCAAGG + Intergenic
1074921699 10:118020718-118020740 GGGAGGTGTCTGCAGGGTTAAGG - Intronic
1075899024 10:126023424-126023446 TGGAGGCATCTGCCAAGTTAGGG + Intronic
1077379380 11:2221865-2221887 TGAAGGAGTCTGCCTGCTTATGG - Intergenic
1077910047 11:6565638-6565660 GGGAGGAATCAGACTCCTTAGGG - Intronic
1079939117 11:26655936-26655958 GGCAGGAATCTGTCTCATTAAGG + Intronic
1081665940 11:44917174-44917196 GGGAGGGTTCTCCCTGCTTAGGG + Intronic
1083816114 11:65133405-65133427 AGGAGGAGTCTGCCTGGGCAAGG - Intronic
1086854376 11:91848875-91848897 GGGAGAAAGCTGGCTGGATAAGG + Intergenic
1089501357 11:118933437-118933459 GTGAGGAAACTGCTTGGTGAAGG + Intronic
1090955432 11:131509416-131509438 GGGAAGAATCTGCCTGTATCTGG - Intronic
1091087488 11:132736410-132736432 TGGAGGAATATGAATGGTTAAGG + Intronic
1091461373 12:645957-645979 GGGAGGAAGCTGACTTCTTATGG + Intronic
1091641170 12:2238792-2238814 GGAGAAAATCTGCCTGGTTAAGG + Intronic
1092008441 12:5088657-5088679 GGGTGGAATCTGGATGGTTTTGG - Intergenic
1092735343 12:11577196-11577218 GGGAGGAATCTGTCCGGCAAAGG - Intergenic
1093068396 12:14683164-14683186 TGGAGACATCAGCCTGGTTAAGG + Exonic
1094496882 12:30994280-30994302 GGGAGGAATTGACCTGGGTATGG - Exonic
1098586732 12:72163401-72163423 TGCAGGAATCTGACTGGCTATGG - Intronic
1098820422 12:75221013-75221035 GAGAGGAGGCTGCCTGGTAATGG - Intergenic
1098899890 12:76101883-76101905 GGGAGGAATGTGCCTGCCCAGGG - Intergenic
1102689835 12:114751709-114751731 GGGAGGAATAGGCCTGGGGATGG - Intergenic
1106230151 13:27815304-27815326 GGCAGGAATCCGCCTGGTGTGGG - Intergenic
1108480832 13:50869200-50869222 GGGTTGAAACTGCCTGATTACGG - Intergenic
1112061335 13:95742321-95742343 GGCAGGATGCTGCCTGGTAAGGG + Intronic
1113868679 13:113545194-113545216 GTGAGGTATGTGCCTGGTTCAGG - Intronic
1121425929 14:93852068-93852090 GGGGGCAGTCAGCCTGGTTATGG - Intergenic
1121638891 14:95472273-95472295 GTGAGGAAGCTGCCTGGCTCAGG + Intronic
1128644177 15:69362849-69362871 GGGAGGGATCAGGCTGGTGAAGG - Intronic
1132048155 15:98582952-98582974 GGGAGGAATCTGCAAGGAGATGG - Intergenic
1133685190 16:8159765-8159787 GGCAGGGCTCTGCCTGTTTATGG + Intergenic
1134151984 16:11812282-11812304 GTGAAGAATCTGGCTGGTCATGG + Intergenic
1136625915 16:31462207-31462229 GGGGTGAGTCTGCCAGGTTACGG - Exonic
1137591587 16:49697044-49697066 GGGAGGAGGCTGGCTGGTGACGG + Intronic
1141602192 16:85133701-85133723 GGGAGGAAACTGGCTGGTAGAGG + Intergenic
1142290922 16:89193273-89193295 GGGAGGAAGCCGCGAGGTTAGGG - Intronic
1143183592 17:4998193-4998215 CGGAGGAATGTGCCGGGTTGGGG + Intronic
1143435112 17:6918627-6918649 GGGAGCAAGCTGTCTGGTTGGGG - Intronic
1151989361 17:77564384-77564406 GGGAGGGATCTCCCTGGCTCGGG - Intergenic
1155643669 18:28050974-28050996 GTTAGGAATATGCCTGGTTAAGG - Intronic
1155753615 18:29461329-29461351 TGAAGGAATATACCTGGTTATGG - Intergenic
1156419396 18:36934183-36934205 GGGAGGAAGCTGCCTGCACAGGG - Intronic
1158344558 18:56503038-56503060 AGGAGGAATCCTCCTGGTAATGG + Intergenic
1160340130 18:78082611-78082633 CGGAGGACTCTGCCTCGTTGAGG + Intergenic
1160802498 19:976865-976887 GGGCGGAATCACCCTGGTTAAGG - Intergenic
1160848497 19:1177883-1177905 GGCAGGAATCTGCCAAGTTGGGG + Intronic
1162099508 19:8331439-8331461 GGGAGGGATCTGCGTGTTTAGGG + Intronic
1165867011 19:38945503-38945525 GGGAGGAATCTGGGTGGTCCTGG + Intronic
926858552 2:17283529-17283551 TGGAGGAATCTGCCTTGGAAAGG + Intergenic
928353518 2:30585863-30585885 GGCAGTAATCTGCATGGTTTAGG - Intronic
929536415 2:42787076-42787098 GGGAGGAATCTGGCTGGAGGTGG - Intronic
929685390 2:44029565-44029587 GAGAGCAATCTGCCTGGGTGAGG - Intergenic
930095113 2:47560906-47560928 GGGAGGCTTCTGCCTGGGAAGGG + Intronic
931580738 2:63769966-63769988 GGGGGGACTCTACCTGCTTAAGG - Intronic
934055799 2:88250450-88250472 GGGAAGACTCTGAGTGGTTAAGG - Intergenic
935033899 2:99349077-99349099 GACAGGAAGCTGCCAGGTTAAGG + Intronic
935838294 2:107078891-107078913 GGGAGAAGTCTACCTGGTGAGGG + Intergenic
938325216 2:130393853-130393875 GAGAGGACTCTGCCTTGCTAGGG - Intergenic
942444009 2:176066576-176066598 GGGTGGAGTCTGCCAGGTGAGGG - Intergenic
946641185 2:221785011-221785033 AGTAGGAATCTGGCTGGGTACGG + Intergenic
1168956838 20:1840473-1840495 GGCAGGAAACTGCCTGGATGGGG + Intergenic
1170362463 20:15561428-15561450 GGGCTGAATCTGGCTGGGTAGGG + Intronic
1173290508 20:41710860-41710882 CGTAGCATTCTGCCTGGTTAGGG - Intergenic
1174437760 20:50523160-50523182 GGGAGGAATGTTCCAGATTAGGG + Intronic
1174756653 20:53165691-53165713 GAGTGGAAGCTGCCTAGTTAAGG + Intronic
1175131193 20:56790896-56790918 GGAAGGAATGTGGCAGGTTAGGG + Intergenic
1175894006 20:62328083-62328105 GGGAGGATGCTGCCTGGGTGGGG - Intronic
1178690056 21:34743149-34743171 GGGAGGCATCTTCCTTCTTATGG + Intergenic
1179055550 21:37928698-37928720 TGCAGGGATCTGACTGGTTATGG - Intergenic
1182777451 22:32841352-32841374 GGGAGGAATGTGCATGGATCAGG + Intronic
1182897187 22:33868629-33868651 GGGAGGAATCTGCCTGGTTAGGG - Intronic
1185207068 22:49545971-49545993 GGGAGGAATCATCCTGGAGATGG + Intronic
949843642 3:8349189-8349211 GGGTGGCAGCTGCCTGGTCATGG - Intergenic
951731605 3:25815937-25815959 GGGAGGAATTTGGCTGGGGATGG + Intergenic
952093994 3:29926300-29926322 TTTAGGAATTTGCCTGGTTAGGG - Intronic
956844492 3:73169923-73169945 GGGAGGAAACAGCCTGCCTATGG - Intergenic
958445239 3:94207021-94207043 GTGAGGAAGCTGCCTGGCTGGGG + Intergenic
961332307 3:126149764-126149786 GGGAGGCCTCTGCCCTGTTAGGG + Intronic
962864939 3:139440715-139440737 AGGGGAAATCTGCCTGGTCAGGG - Intergenic
964681158 3:159341078-159341100 GGGTGATATCTGCCTGCTTACGG + Intronic
965054970 3:163699889-163699911 GTTAGGAATCTGCTGGGTTAAGG + Intergenic
966975258 3:185077248-185077270 GGAAGGTATCTGCTGGGTTAGGG + Intergenic
968881049 4:3300418-3300440 GGGAGGAATCTGGCTGCTAAAGG - Intronic
969676383 4:8616602-8616624 GGAAGGAATCGGCCCGGTGAGGG + Intronic
969694356 4:8726225-8726247 GGGTGGAATCTGCCTGTATTTGG + Intergenic
969816311 4:9690355-9690377 GGGATGGGTCTGCGTGGTTAAGG - Intergenic
977900022 4:102411747-102411769 GGGAGGAAAATGCATGTTTATGG - Intronic
983383773 4:167030919-167030941 TGGAGCAATGTGCCTGGTTCAGG - Intronic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984879327 4:184396722-184396744 GTGAGGAATCTGGCTGGGTGTGG - Intronic
985481144 5:111551-111573 GGGAGGAATGGGCCTGGATTTGG + Intergenic
986557381 5:9025370-9025392 TGGAGAGATCTGCCTGGGTATGG + Intergenic
987268533 5:16280594-16280616 TAGAGGACTATGCCTGGTTAGGG + Intergenic
990452996 5:55954165-55954187 GGCAGGAATCTCTCTGCTTAGGG + Intronic
995058432 5:107788011-107788033 GGTAGGAATCTGGATGGTAAAGG + Intergenic
995065052 5:107852102-107852124 GGGAGGAAGATGCCTGGGTTTGG + Intergenic
996563747 5:124857971-124857993 GGGAGGAACATGCTTGGTCAGGG - Intergenic
999186604 5:149715313-149715335 GGGAAGAACATGCCAGGTTAAGG + Intergenic
1002761442 6:205565-205587 GTAAGGAATATGCCTGGTAATGG + Intergenic
1007622121 6:43221659-43221681 TGGAGGAAGCTGGCTGGTCAGGG - Intronic
1011656533 6:89557033-89557055 GGGAGGAATGTTCCAGATTAGGG + Intronic
1017314874 6:153019255-153019277 GGTAGAAATCTGCCTAGTGATGG - Intronic
1018188451 6:161288028-161288050 GGGAGGCAACTGCCTTGTCAGGG - Intergenic
1024821158 7:53331307-53331329 GGGAGGAATTTGCATCTTTAGGG - Intergenic
1024881881 7:54096208-54096230 GGGAGGACTCTCTCAGGTTAGGG - Intergenic
1026019221 7:66694904-66694926 TGGAGGTATCAGCCTGGTTCCGG + Intronic
1035704800 8:1667399-1667421 GGGAGGAGACTGGCTGGTGACGG + Intronic
1037287137 8:17313334-17313356 TGGAGAACTCTGGCTGGTTAAGG - Exonic
1038341542 8:26690293-26690315 GGTAGGAATCTGCGTAATTACGG + Intergenic
1040765833 8:50909957-50909979 GGGAGGAATCTCCAGTGTTAGGG + Intergenic
1041031842 8:53744859-53744881 GGGAGGAATTTACCAGGTAAAGG - Intronic
1047962898 8:130023943-130023965 CAGAGAAATCTGCCTGGTTGAGG + Intergenic
1049744908 8:144259170-144259192 GGGTGGAAGGTGCCTGGGTAGGG + Intronic
1050983747 9:12055011-12055033 GGGAGGGAGCTTCCAGGTTATGG + Intergenic
1052656754 9:31373224-31373246 GGAAGAAAACTGCCTGCTTAGGG + Intergenic
1055236960 9:74133808-74133830 GAGAGGAATCTGGCTGGAGATGG - Intergenic
1056271842 9:84954772-84954794 TGGAGGAATCAGCTTGGTTGGGG + Intronic
1060731360 9:126039112-126039134 CTGAGGAATTTGCCAGGTTAGGG - Intergenic
1061309925 9:129755463-129755485 AGGAGGAACCTGCCTGCCTAAGG - Intergenic
1186376661 X:9010699-9010721 CGGAGGAAGCTGCATGGTCAAGG - Intergenic
1190969410 X:55334267-55334289 GGTAGAGATGTGCCTGGTTAAGG - Intergenic
1194090735 X:89580182-89580204 GGGAGGGATCTTTTTGGTTAGGG + Intergenic
1195529323 X:105934186-105934208 GGGAGAAATATGCCTAGTGAGGG - Intronic
1195604238 X:106784313-106784335 GGGAAGAATCTACCAGGTGAGGG - Intronic
1198457218 X:136828533-136828555 GGGAGGAATGTGTGTGGTCATGG - Intergenic
1199941558 X:152632719-152632741 AGGAGAAATCTGACTGGATAAGG + Intergenic
1200443387 Y:3236242-3236264 GGGAGGGATCTTTTTGGTTAGGG + Intergenic