ID: 1182898361

View in Genome Browser
Species Human (GRCh38)
Location 22:33877000-33877022
Sequence CAGTGGTACCATTAGATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182898361 Original CRISPR CAGTGGTACCATTAGATGGT GGG (reversed) Intronic
902274700 1:15331033-15331055 CAGTGGTAGGACTGGATGGTTGG + Intronic
907087962 1:51695459-51695481 CAGTGGAACCATGAGGTAGTTGG + Intronic
908354970 1:63319951-63319973 CAGTGTTACCATCTGATGCTGGG - Intergenic
912095320 1:106133741-106133763 CAATGGAACCATTAAATGTTTGG - Intergenic
914018725 1:143845118-143845140 CAGTGGCACCATTTGAGGCTGGG + Intergenic
914657278 1:149753321-149753343 CAGTGGCACCAATAGAGGCTGGG + Intergenic
919093370 1:192999799-192999821 CACTGGTGCCAGTAGAGGGTTGG + Intergenic
920361108 1:205417079-205417101 CACTGGTACCATTAGAGTGGAGG - Intronic
922405574 1:225309562-225309584 CAGTGGCACCTTCAGGTGGTTGG - Intronic
922727480 1:227929476-227929498 AAGTGGTAGCATTAGGAGGTGGG + Intronic
1063884084 10:10560391-10560413 CAATGGAAACATTAGATGGTTGG - Intergenic
1065306781 10:24376783-24376805 CAGTGGTAAGATTGGTTGGTTGG - Intronic
1074892062 10:117744041-117744063 CAGTGGTTCCATCAGTAGGTGGG - Intergenic
1077867184 11:6232866-6232888 TAATGGTAACAGTAGATGGTGGG - Intronic
1078608828 11:12801678-12801700 CAGTGATGCCAGAAGATGGTTGG + Intronic
1085905218 11:80751982-80752004 AAGAGCTACCATTAGATTGTTGG + Intergenic
1091747881 12:3004090-3004112 CAGTGGTACCCACAGCTGGTGGG - Intronic
1092053034 12:5486508-5486530 AAGTGATACCATTACAAGGTAGG - Intronic
1093053788 12:14534283-14534305 CAGTTGAACCCTTAGATGTTTGG + Intronic
1093779583 12:23120304-23120326 CACTCGTACCCTTGGATGGTAGG + Intergenic
1093910556 12:24742569-24742591 CAGTGGAACCAATAGACCGTGGG + Intergenic
1094141386 12:27185526-27185548 CAGTTATACCATTTGATGCTGGG + Intergenic
1095585451 12:43844426-43844448 CAGAGGTATGATTAGATGTTAGG + Intronic
1108158240 13:47610787-47610809 CAGTGCTACCAGTAGATGAGAGG - Intergenic
1109958197 13:69596751-69596773 CAGTGGTAGCCTTTGGTGGTGGG - Intergenic
1112428869 13:99332089-99332111 CTGTTGTCCCAGTAGATGGTCGG + Intronic
1114636081 14:24187649-24187671 GAGAGGTACCATCACATGGTTGG - Exonic
1117652246 14:57919115-57919137 CAGAGGAACCATGAGATGGAAGG + Intronic
1132973762 16:2701487-2701509 CAGGGGTACCCTTAGCTGCTTGG + Intronic
1135533530 16:23275033-23275055 CAGTGGAGCCATTAGATAGAAGG - Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1140596929 16:76426679-76426701 CATTGCAACCATTACATGGTAGG - Intronic
1141940708 16:87274187-87274209 CAGTTGTCTCATTGGATGGTGGG - Intronic
1153485245 18:5591517-5591539 CAGTGATACTATTAGAAGATGGG - Intronic
1164529414 19:29036806-29036828 CAGTGGCAGCATTAGGTGGTTGG - Intergenic
925960981 2:9015790-9015812 CAGTGGTCTCATTTGATGGCCGG + Intergenic
926600630 2:14840845-14840867 CACTGGTACAATTAAATGGATGG + Intergenic
928621843 2:33097591-33097613 GAGTGGTACCATTATAAAGTGGG - Intronic
929420229 2:41782756-41782778 TAGTGTTACCACTAGATGGCAGG - Intergenic
936562711 2:113555662-113555684 CATTGGTGCCATTAGAAGGACGG + Intergenic
943749575 2:191497271-191497293 CCGTGTTGCCAATAGATGGTTGG + Intergenic
946507501 2:220317480-220317502 CAGGGTTAACAGTAGATGGTCGG - Intergenic
947498765 2:230657447-230657469 CTGTGGTACCAGGAGAGGGTTGG - Intergenic
1182898361 22:33877000-33877022 CAGTGGTACCATTAGATGGTGGG - Intronic
1183759060 22:39799165-39799187 CAGTGGTGGCAGTGGATGGTGGG + Intronic
1184358861 22:44001603-44001625 AAGTGGGACCATTAGAAGTTAGG + Intronic
955612504 3:60772842-60772864 CAGAGGAACCATCAGTTGGTGGG - Intronic
955963230 3:64362453-64362475 GATGGGTACCATTAGATGCTAGG - Intronic
959496555 3:107058676-107058698 CAGTGTTACCATTTGGTGGCTGG - Intergenic
962248375 3:133818141-133818163 CATTGGAACAATTGGATGGTTGG + Intronic
966014396 3:175123327-175123349 TGGTGGTACTAATAGATGGTAGG + Intronic
969959559 4:10929936-10929958 TAGTGGAACCATTAGATTGCTGG - Intergenic
971916466 4:32876010-32876032 CATTGGTATTTTTAGATGGTTGG - Intergenic
973231524 4:47844580-47844602 CAGTGGTAGAATTACAGGGTTGG - Intergenic
974077638 4:57182221-57182243 CAGTGGTAACATCAGTTGGTGGG + Intergenic
975295350 4:72727934-72727956 CAGTGGAAACATTACATGCTAGG + Intergenic
977072807 4:92413475-92413497 CAGTAGTAAGATTAGATTGTGGG + Intronic
977745952 4:100547762-100547784 CATTCCTACCATTAGGTGGTTGG + Intronic
978788732 4:112638652-112638674 CAGTGGTCCCATAAGATTATAGG + Intronic
978883677 4:113740613-113740635 CAGTGCCACCATTAGATAGTTGG + Intronic
981047477 4:140278651-140278673 CAGTGATAGTATTAGAAGGTAGG - Intronic
987481600 5:18465768-18465790 CGGTGTTTCCATGAGATGGTGGG - Intergenic
988485220 5:31662935-31662957 TAGTGATAGCATTAGAAGGTGGG - Intronic
991334121 5:65527975-65527997 AAGTGGGACGATTAGATGCTAGG - Intronic
1006837352 6:37007037-37007059 CAGTACTACCAGTAGCTGGTGGG + Intronic
1012253017 6:97000198-97000220 AAGTGGTACTATTAGAGAGTTGG + Intronic
1014229918 6:118891952-118891974 CTGTTGTACAATTAGATGTTTGG + Intronic
1016661619 6:146587678-146587700 CAGTTCTATCATCAGATGGTTGG - Intergenic
1017374603 6:153754165-153754187 CTGTGGTTCCATTGGCTGGTGGG - Intergenic
1017967485 6:159279082-159279104 CAGTGATACCAGGAGAAGGTTGG + Intergenic
1018999318 6:168735352-168735374 CAGTGGCAGCTTTAGATGGTTGG + Intergenic
1021327651 7:19294218-19294240 CAGTGGTAACATGTGATGTTTGG + Intergenic
1021556154 7:21920543-21920565 CAGTGATTTTATTAGATGGTGGG - Intronic
1022583340 7:31579485-31579507 CACTGAAACCATAAGATGGTAGG + Intronic
1023611705 7:41978329-41978351 CCGTGGTACCATAAGCTGTTGGG + Intronic
1027588150 7:80083809-80083831 CAGAGGTACCATCAGATTTTGGG + Intergenic
1028151949 7:87383937-87383959 CAGTGGGATCATCAGATTGTAGG + Intronic
1028411867 7:90538738-90538760 CAGTGTTACCATGATATTGTGGG - Intronic
1031789307 7:126080290-126080312 ATGTGGTAACATTAGATTGTAGG - Intergenic
1034479974 7:151312276-151312298 CGGTGGTCCCATAAGATGATGGG - Intergenic
1035372577 7:158388715-158388737 CCAAGGCACCATTAGATGGTTGG - Intronic
1037331657 8:17749018-17749040 AAGTGGTCCCTTCAGATGGTTGG - Intronic
1038993701 8:32898155-32898177 GAGTGATACCATAAGAAGGTGGG + Intergenic
1040746931 8:50655149-50655171 CTAAGGTAACATTAGATGGTGGG + Intronic
1041411893 8:57565207-57565229 GAGAGGTACCAGTAGATGCTGGG - Intergenic
1041411897 8:57565241-57565263 GAGGGGTACCAGTAGATGCTGGG - Intergenic
1044753879 8:95441928-95441950 CAGTTGTACCATCACATGCTTGG - Intergenic
1049890022 9:60037-60059 CATTGGTGCCATTAGAAGGACGG - Intergenic
1051256469 9:15218842-15218864 CAGTGGAACCAATATATTGTGGG - Intronic
1052951343 9:34215441-34215463 CAGTGAGAACATTAGATGTTTGG - Intronic
1053731500 9:41061312-41061334 CATTGGTGCCATTAGAAGGACGG - Intergenic
1054697012 9:68370783-68370805 CATTGGTGCCATTAGAAGGACGG + Intronic
1054949072 9:70828954-70828976 CAGTGGAAACATAAGATGATGGG + Intronic
1192633010 X:72791462-72791484 CAGTGGTTCCATTAGGCTGTGGG + Intronic
1192648699 X:72929339-72929361 CAGTGGTTCCATTAGGCTGTGGG - Intronic
1197638335 X:128941434-128941456 GAGTGGAACCATTTCATGGTGGG - Intergenic
1198564738 X:137892955-137892977 CTGTGGTACATTTAGATGATAGG + Intergenic