ID: 1182899375

View in Genome Browser
Species Human (GRCh38)
Location 22:33885278-33885300
Sequence GATATCAGCTTGAAATAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 198}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182899375_1182899377 -2 Left 1182899375 22:33885278-33885300 CCACTTTATTTCAAGCTGATATC 0: 1
1: 0
2: 1
3: 19
4: 198
Right 1182899377 22:33885299-33885321 TCTTAGCTGACCCTCTGCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 68
1182899375_1182899380 1 Left 1182899375 22:33885278-33885300 CCACTTTATTTCAAGCTGATATC 0: 1
1: 0
2: 1
3: 19
4: 198
Right 1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 79
1182899375_1182899379 0 Left 1182899375 22:33885278-33885300 CCACTTTATTTCAAGCTGATATC 0: 1
1: 0
2: 1
3: 19
4: 198
Right 1182899379 22:33885301-33885323 TTAGCTGACCCTCTGCGGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1182899375_1182899378 -1 Left 1182899375 22:33885278-33885300 CCACTTTATTTCAAGCTGATATC 0: 1
1: 0
2: 1
3: 19
4: 198
Right 1182899378 22:33885300-33885322 CTTAGCTGACCCTCTGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 88
1182899375_1182899376 -5 Left 1182899375 22:33885278-33885300 CCACTTTATTTCAAGCTGATATC 0: 1
1: 0
2: 1
3: 19
4: 198
Right 1182899376 22:33885296-33885318 ATATCTTAGCTGACCCTCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182899375 Original CRISPR GATATCAGCTTGAAATAAAG TGG (reversed) Intronic
902740496 1:18434558-18434580 GATATCAGTTTGAGGTCAAGTGG - Intergenic
906729564 1:48069611-48069633 GATCTGAGCTTAAAATAAAGGGG - Intergenic
908950429 1:69555472-69555494 TATATAAGCTTGAAATGCAGAGG - Intergenic
909097854 1:71311804-71311826 GAGATCAGCTTTATATAAACAGG + Intergenic
909145575 1:71926321-71926343 GTTTTCAGCTTGAATTAGAGTGG - Intronic
909766105 1:79358064-79358086 GATATCAGCAGGAAATAAATAGG - Intergenic
910015381 1:82517471-82517493 GATATTTTCTTGAAAGAAAGTGG - Intergenic
917235714 1:172889450-172889472 GATCTCAGATAGAAATAAGGAGG - Intergenic
917576768 1:176330656-176330678 TATAGCAACTTGAAATAAAAGGG + Intergenic
918873678 1:190010166-190010188 CATATGAACTTAAAATAAAGGGG + Intergenic
918968877 1:191386589-191386611 TATATTTGCTTGGAATAAAGAGG - Intergenic
919092735 1:192994007-192994029 GACATGAATTTGAAATAAAGTGG + Intergenic
919608104 1:199711230-199711252 CACATCAGCTCAAAATAAAGCGG + Intergenic
921653223 1:217703999-217704021 AATAGCAACATGAAATAAAGAGG - Intronic
921885756 1:220303516-220303538 AACATTAGCTTCAAATAAAGTGG - Intergenic
923598390 1:235379151-235379173 GGTATCAGCTAGAAAGAAAAGGG - Intronic
923746606 1:236706762-236706784 GATCTCAGTTATAAATAAAGTGG - Intronic
924184185 1:241470004-241470026 GATAACAGCATGCAATAAATAGG - Intergenic
924265626 1:242278894-242278916 GATGTTACTTTGAAATAAAGGGG + Intronic
1064502514 10:15989795-15989817 GAAAGCAGGCTGAAATAAAGGGG - Intergenic
1064855042 10:19757472-19757494 AATATCAGTATGAATTAAAGTGG + Intronic
1065475569 10:26133991-26134013 GGTATCAGCTTAGAATAAGGAGG - Intronic
1066042060 10:31558337-31558359 CAAATCAAGTTGAAATAAAGAGG + Intergenic
1066719215 10:38319758-38319780 GATGTTACTTTGAAATAAAGGGG - Intergenic
1069249704 10:66253367-66253389 GATCAAAGCTTGAAAAAAAGAGG - Intronic
1071000974 10:80830140-80830162 GGTATCAGGTTTAAATACAGGGG + Intergenic
1073789467 10:106925445-106925467 GAAATTAGCTTGAAATACAGAGG + Intronic
1074332663 10:112533247-112533269 GACACCATCATGAAATAAAGGGG - Intronic
1078199187 11:9164739-9164761 GCTATCAGATAAAAATAAAGGGG + Intronic
1079892357 11:26072376-26072398 GATATCATTTTGGAATAAAATGG - Intergenic
1082747867 11:56985829-56985851 CATATAGGTTTGAAATAAAGGGG - Intergenic
1084714268 11:70863707-70863729 GATCTCATCTCCAAATAAAGAGG - Intronic
1086938734 11:92772418-92772440 GATAACAACATGAAATAAAATGG - Intronic
1087043204 11:93821559-93821581 GATTTCATGTTGAAATAAAAGGG - Intronic
1087087037 11:94230345-94230367 TTTACCAGCTTGAAATAAATTGG + Intergenic
1088459773 11:110070350-110070372 GATATCAGATTGGAATACATGGG - Intergenic
1089379503 11:118017583-118017605 GAGAGCAGTTTTAAATAAAGTGG + Intergenic
1090561816 11:127941064-127941086 GATATCAACTTCAACTAAAATGG - Intergenic
1090570878 11:128043848-128043870 AATATCATCCTGAAATAAGGTGG + Intergenic
1091351055 11:134894524-134894546 CATATCACCTATAAATAAAGGGG + Intergenic
1095449972 12:42320305-42320327 GAGATCATTATGAAATAAAGTGG - Intronic
1095913533 12:47453431-47453453 CACATCATCTTGAAATGAAGTGG - Intergenic
1095915650 12:47475273-47475295 GAGATCTGCTGGAAGTAAAGTGG - Intergenic
1097989668 12:65822457-65822479 GATAGCAGCCTGAAAACAAGTGG + Intergenic
1098631836 12:72732689-72732711 TGTAACAGCTTGAATTAAAGGGG - Intergenic
1098670103 12:73218013-73218035 GTTACCAGCTAGAGATAAAGAGG + Intergenic
1099270435 12:80502283-80502305 TTTATTAGCTTCAAATAAAGAGG + Intronic
1099305643 12:80951569-80951591 GAACTCATCTTGAAATAAATAGG - Intronic
1099335914 12:81356959-81356981 GATAACAGCTTGAAAAACACTGG - Intronic
1102842476 12:116140304-116140326 GATATAACCTTGAAACAAACAGG - Intronic
1103320769 12:120091738-120091760 GGTTTCAGCATGAAACAAAGGGG - Intronic
1106996602 13:35491364-35491386 CATACCAGCTTGAAATTAAGGGG - Intronic
1107204391 13:37764172-37764194 GATTTCAGCTAGAAATGAAGGGG + Intronic
1107240603 13:38230065-38230087 GATAACACATTGACATAAAGCGG + Intergenic
1108238116 13:48430301-48430323 GATAGCAATTTGAAAAAAAGAGG + Intronic
1110627768 13:77670357-77670379 CATATAAACTTAAAATAAAGGGG + Intergenic
1110630957 13:77707893-77707915 GATCTCAGGTTGAGATGAAGAGG + Intronic
1111108996 13:83683279-83683301 TATATCAGCTTAAACAAAAGGGG + Intergenic
1111520627 13:89398207-89398229 GATAACAGAAAGAAATAAAGGGG - Intergenic
1112368964 13:98778141-98778163 AATATCAGCGTGAGAGAAAGGGG + Intergenic
1113048239 13:106180047-106180069 TATATCAGCTTGGACTGAAGTGG + Intergenic
1113146712 13:107216026-107216048 GTTGTCAGCTTCAAATCAAGAGG + Intronic
1113279699 13:108776104-108776126 GATAACACCTTGATACAAAGGGG - Intronic
1113613171 13:111662232-111662254 GAGAGCAGCTTGAAATTGAGAGG + Intronic
1114158840 14:20139528-20139550 GATAACAGCTTGAATCTAAGTGG - Intergenic
1115577439 14:34725011-34725033 GACATAAGCTCCAAATAAAGTGG - Intergenic
1115907450 14:38215677-38215699 GATATCAACTAGAAAAGAAGGGG + Intergenic
1116680803 14:47967540-47967562 GATATTTGCTAGAAAAAAAGAGG + Intergenic
1117154921 14:52929294-52929316 GATGGCAGCTTGAAATAGGGTGG - Intronic
1117458788 14:55924378-55924400 GATTTCAGCTTGCAACAAATTGG + Intergenic
1118290970 14:64522633-64522655 GATGTCAGCATAAAAAAAAGTGG + Exonic
1118954990 14:70472644-70472666 GATCTCAGCCTGAAATTAATTGG + Intergenic
1119131581 14:72177833-72177855 GATAACAGCATGAAGTAAACTGG - Intronic
1123961422 15:25405632-25405654 GATGTCAACATGAAAGAAAGTGG + Intronic
1124080017 15:26484889-26484911 GATAACATCTTAAAAAAAAGGGG + Intergenic
1125653971 15:41340783-41340805 TATTTCAGCTAGTAATAAAGTGG - Intronic
1125975450 15:43947374-43947396 GTTATCAGCATGAAATTGAGAGG - Intronic
1129562852 15:76589875-76589897 GAGAGCAGCATGAAATACAGGGG - Intronic
1132767126 16:1540034-1540056 GGAAGCAGCTTGAAATACAGTGG + Intronic
1134876167 16:17700836-17700858 GATATCTAATTGAAAGAAAGAGG + Intergenic
1139851850 16:69955307-69955329 TATTTCAGATTGAAAAAAAGTGG - Intronic
1139880822 16:70178213-70178235 TATTTCAGATTGAAAAAAAGTGG - Intronic
1140371685 16:74417304-74417326 TATTTCAGATTGAAAAAAAGTGG + Intronic
1147532333 17:41291210-41291232 GCTCTCAGCCTGAAATAAGGAGG - Intergenic
1148041028 17:44707475-44707497 GATAGCAGCTTGAACTAGGGTGG + Intergenic
1150192454 17:63257678-63257700 GTTATCAGTTTGAAATAAATGGG - Intronic
1156094527 18:33512908-33512930 GTTATCAGCTTAAAATAATGGGG + Intergenic
1156954121 18:42940964-42940986 GATATCAACTAGGAATAAATGGG - Intronic
1159274763 18:66203818-66203840 GATATCAGATAGAAACAGAGAGG - Intergenic
1160029021 18:75242602-75242624 GATATCATCTTCAAACAAAATGG + Intronic
1161044865 19:2129361-2129383 GTCATCAGCTTGAAAAAGAGCGG + Exonic
1164528724 19:29030812-29030834 GATATCAGCGTCCTATAAAGGGG + Intergenic
1168122752 19:54261945-54261967 AGGATCAGCTTGGAATAAAGAGG + Intronic
926520947 2:13912379-13912401 AATATCAGCTTGAAATGTAGAGG - Intergenic
926947903 2:18208993-18209015 CATATCAGTTTAAAATAAACTGG - Intronic
926966987 2:18425715-18425737 GAAACCAGCTAGAAATAAACTGG + Intergenic
928326835 2:30325920-30325942 AACATCAGCTTTAAACAAAGGGG - Intergenic
929242140 2:39665003-39665025 CATAGCAGGTTGAAATGAAGTGG + Intronic
934586079 2:95497121-95497143 GATATCACCTTTAAAGAAACAGG + Intergenic
940395546 2:153186321-153186343 CAAATAAGCTTGAAATAAAGAGG - Intergenic
940489786 2:154344453-154344475 GATATTAGCTTGACATCATGGGG + Intronic
941220230 2:162769239-162769261 CATATCAGGTAGAAATAAACTGG - Intronic
943815058 2:192243099-192243121 TGTATCAGTCTGAAATAAAGGGG + Intergenic
945746714 2:213727428-213727450 GATATCAATTTTAAATAAGGTGG + Intronic
945794691 2:214347761-214347783 TATATCAGCTTGGACTAGAGGGG + Intronic
945861012 2:215122377-215122399 TAAATCAGATTGAAATAAACTGG - Intronic
947010398 2:225559701-225559723 AATATTAGATTGAAATGAAGTGG + Intronic
1172390818 20:34563850-34563872 AACATCAGCTTGAAATCACGTGG + Intronic
1177509701 21:22069303-22069325 AATATCAGAATGAAATAAAATGG + Intergenic
1177958902 21:27637089-27637111 AATGTCAGCTTGAACTAAAAGGG + Intergenic
1179412418 21:41172277-41172299 GAAATCAGCTTGAAACAACAAGG + Intronic
1179608300 21:42532619-42532641 GATACCAGCTTGATACAGAGAGG + Intronic
1180011951 21:45057146-45057168 GAGGTCAGCATGAGATAAAGGGG + Intergenic
1180744731 22:18079603-18079625 GAAATCAGATTTAAATGAAGAGG - Intronic
1182253930 22:29024475-29024497 GATAACAAGTTGATATAAAGTGG + Intronic
1182408643 22:30161790-30161812 TTTATCACTTTGAAATAAAGGGG + Intronic
1182579471 22:31296884-31296906 AATAAATGCTTGAAATAAAGGGG + Intergenic
1182899375 22:33885278-33885300 GATATCAGCTTGAAATAAAGTGG - Intronic
949261668 3:2108565-2108587 GATAACAGCTTGAAATTTGGAGG + Intronic
949426769 3:3926019-3926041 GATATCAACTTGAGAGACAGAGG - Intronic
949595734 3:5545112-5545134 GTTATCAGCTTAAAATAGACTGG - Intergenic
950909698 3:16576266-16576288 GAGATCAGCTGGGAACAAAGAGG + Intergenic
952601446 3:35088627-35088649 GATAGCAGAGTGAAATACAGGGG + Intergenic
952747133 3:36792052-36792074 TATAACATCTTGAAATAAGGAGG - Intergenic
953483030 3:43268740-43268762 GATATCAATCTGCAATAAAGAGG - Intergenic
953601724 3:44372528-44372550 GAGATCAGATTGATATAAATGGG - Intronic
956571681 3:70703692-70703714 GAGAGCAGGTTGAAATAGAGGGG - Intergenic
956758891 3:72419825-72419847 GATATAAGCTTTAAATAAGGTGG + Intronic
957327544 3:78715934-78715956 GATATCAGGTTGAAACTAAGAGG - Intronic
957498325 3:81020150-81020172 GAAATCAGCTTGGCATAAACAGG - Intergenic
957626317 3:82657043-82657065 GTGATCAGCTTGAAAGGAAGGGG - Intergenic
957866647 3:86033645-86033667 TATATAAACTTGAAATGAAGTGG - Intronic
960656630 3:120011537-120011559 AATCTCAGCTTAAAATTAAGAGG - Intronic
963633148 3:147759166-147759188 GATATCAACATGAAAAAATGGGG + Intergenic
964097477 3:152949732-152949754 GATTTCATCTTGAAATAAATGGG - Intergenic
965032335 3:163388521-163388543 GATGTCACTTTTAAATAAAGAGG - Intergenic
967366015 3:188687322-188687344 CATATCAGCTAGTAAGAAAGTGG - Intronic
967901924 3:194463743-194463765 TATATCATCTTAAAATAAATAGG - Intronic
972727082 4:41754167-41754189 GACATCTGCTTGTAACAAAGGGG + Intergenic
974691400 4:65301909-65301931 CATATTAGCTTGAAAGAATGGGG + Intergenic
975242133 4:72072529-72072551 GAAAAAAGATTGAAATAAAGTGG + Intronic
975289666 4:72662622-72662644 AATATCTGCTAGAGATAAAGTGG - Intergenic
975448891 4:74501118-74501140 GAGATCAGCTTGGAATCAGGAGG - Intergenic
976057495 4:81085278-81085300 TGTATCAGCTTGAAATAAAGAGG + Intergenic
976615975 4:87077465-87077487 AATATTAGATTGAAATAAATAGG - Intronic
979492421 4:121343241-121343263 GAAATCAACTTGAAATGAACTGG + Intronic
980591844 4:134900666-134900688 TATATTAGGTTGAAATAATGTGG + Intergenic
983447170 4:167868003-167868025 GATCTCAGCTTGAATTGAATAGG + Intergenic
985075754 4:186212686-186212708 GATAGAAGCTTGCAATCAAGAGG + Intronic
986882452 5:12191876-12191898 GATATAAGATTAAAACAAAGTGG - Intergenic
987426639 5:17780392-17780414 GATTTCATCTTGGAAGAAAGTGG + Intergenic
987660775 5:20872498-20872520 GAAATCATCCAGAAATAAAGGGG + Intergenic
988340440 5:29963188-29963210 GTTATCATCTTAAAATAATGGGG + Intergenic
988762869 5:34333187-34333209 GAAATCATCCAGAAATAAAGGGG - Intergenic
988986468 5:36624064-36624086 GCTATCAGCATCAAATCAAGAGG - Intronic
990967669 5:61466779-61466801 GATATCAGACTGAAAAAAAAGGG - Intronic
991983248 5:72255527-72255549 GTTGTCAGCTTGGACTAAAGAGG - Intronic
992685074 5:79191740-79191762 CACAGCAGCTTGAAATAAATGGG + Intronic
992685077 5:79191789-79191811 AATAACAGCTCGAAATAAATGGG + Intronic
993090143 5:83415472-83415494 GTTATCTGCAGGAAATAAAGAGG + Intergenic
996735235 5:126752226-126752248 AAAATCAGCAGGAAATAAAGCGG - Intergenic
997086000 5:130799653-130799675 GTTATCAGCATGAAATAGACTGG + Intergenic
997925029 5:138022682-138022704 GATATCCTCATGACATAAAGGGG + Intronic
998836302 5:146205338-146205360 GCTTTCTGCTTGAAAGAAAGGGG + Intronic
1000485291 5:161834170-161834192 GATATCAGCCTGAAAAACACTGG - Intergenic
1001883426 5:175265827-175265849 GAAAGAAGCTTGAAAAAAAGTGG + Intergenic
1002545611 5:179942158-179942180 CATCTCAGTATGAAATAAAGAGG + Intronic
1005374479 6:25168469-25168491 AATATCAGATAGAAACAAAGAGG + Intergenic
1007940775 6:45779174-45779196 ACTCTCAGCTTGAACTAAAGTGG - Intergenic
1008490149 6:52078041-52078063 GATTTCAGGTTGAAATAGAGAGG - Intronic
1009962363 6:70539612-70539634 GATACAAGCCTCAAATAAAGTGG - Intronic
1010113761 6:72275452-72275474 GATTTTAGCTTGAAAGAAAAAGG + Intronic
1010188490 6:73169342-73169364 GATATGAGCTTGATATATACAGG + Intronic
1011321011 6:86093591-86093613 CACATAAGCTTAAAATAAAGGGG - Intergenic
1014541799 6:122685154-122685176 GAGATCATCATGAATTAAAGGGG + Intronic
1014662900 6:124194941-124194963 GGTACCAGCTTTAAATGAAGAGG + Intronic
1014685377 6:124492444-124492466 AATATCAGCTTTGAATAAAATGG + Intronic
1016353316 6:143191604-143191626 CAAAGCAGCTTGAAATATAGAGG + Intronic
1016795078 6:148109007-148109029 GATAAAAGACTGAAATAAAGTGG + Intergenic
1017761771 6:157574739-157574761 GATGTTAGCTTGAAATAGGGTGG - Intronic
1022566671 7:31410320-31410342 GCTATCAGTTTGAACTAAAGGGG + Intergenic
1023324523 7:39038715-39038737 GATATCAGCAAGAACTACAGTGG - Intronic
1023654372 7:42404934-42404956 GATATCAGCTTGAAAATGTGTGG + Intergenic
1028405784 7:90472447-90472469 GATATCAGAATGAAATTAAAAGG + Intronic
1031693956 7:124826094-124826116 GGTATCAGCTTGATCTCAAGAGG + Intronic
1031951737 7:127899779-127899801 GATGTTATCTTGAAATAAATTGG + Intronic
1031970092 7:128058512-128058534 GATATCACCCTGAAATCAAGAGG + Intronic
1032980428 7:137275804-137275826 GATCTCAGCTTCAAATGAAAAGG + Intronic
1035218043 7:157384958-157384980 GATATCAACTTCAACTAAAATGG + Exonic
1037393258 8:18416613-18416635 GCTATCAGCTTGAACTGAAGAGG - Intergenic
1043942696 8:86213608-86213630 GTTATTAGCTTGAAAAAAAATGG + Intergenic
1045682331 8:104676139-104676161 AATATATGCCTGAAATAAAGTGG + Intronic
1049552928 8:143268931-143268953 GAGAACAGCTTGAAATCAGGAGG - Intronic
1050776295 9:9265632-9265654 GTTATCAACTTGAAATAGATCGG + Intronic
1051441141 9:17084525-17084547 GATAGAAGCTTTAAATGAAGAGG - Intergenic
1052207498 9:25860791-25860813 GACAGCAGCTTGTTATAAAGTGG + Intergenic
1052511198 9:29423045-29423067 GAAATCAGCTGGAAAAAATGGGG + Intergenic
1052764847 9:32630516-32630538 GCTCTCATCTTGAAATACAGAGG + Exonic
1055684009 9:78751055-78751077 GTTATCAGCTTGAAAGAACTGGG - Intergenic
1061224562 9:129273255-129273277 GACAACAGCTTGTATTAAAGTGG - Intergenic
1061967354 9:134023272-134023294 GATATCAGGTAGAAAAAGAGAGG + Intergenic
1186306864 X:8270783-8270805 AATACCACCTAGAAATAAAGAGG + Intergenic
1186391874 X:9168907-9168929 GATTTCACCTTTAAATAAAAAGG - Intergenic
1188095383 X:26014812-26014834 GATATCAAGTTGAAATAAAAGGG + Intergenic
1188607670 X:32052689-32052711 GAAACCTGCTTGAAATTAAGTGG + Intronic
1189855236 X:45216970-45216992 CATATAAGCTAGAAATAAAGGGG + Intergenic
1190040868 X:47071033-47071055 CATATCAGCCTGTAATAGAGTGG - Intergenic
1190238502 X:48636247-48636269 AATGCCAGCTTGAAAAAAAGAGG - Intergenic
1190429955 X:50369568-50369590 GACCTCATCTTGAAAGAAAGAGG - Intronic
1191178428 X:57532482-57532504 GTTATCAGCTTGAAATACACTGG - Intergenic
1192395546 X:70777343-70777365 TTTATCAGCTTAAAATAAACTGG + Intronic
1192477746 X:71458290-71458312 GCTCTCATCTTGAAATACAGAGG - Exonic
1193088614 X:77470105-77470127 GTTATCAGGTTAAAATAATGAGG + Intergenic
1193488127 X:82113222-82113244 GTTATCAGGTTAAAATAATGGGG - Intergenic
1193679749 X:84503436-84503458 GAAATCAGCTTGACAAATAGAGG + Intergenic
1194845853 X:98808432-98808454 GAGATCAGATTGAAATATACAGG + Intergenic
1195780380 X:108456494-108456516 CATATCATCTGAAAATAAAGAGG + Intronic
1198661569 X:138974366-138974388 GATATAAGCAGGAAATATAGTGG + Intronic
1201491792 Y:14549750-14549772 GAAATCAGCTAGAGAAAAAGAGG + Intronic