ID: 1182899380

View in Genome Browser
Species Human (GRCh38)
Location 22:33885302-33885324
Sequence TAGCTGACCCTCTGCGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182899375_1182899380 1 Left 1182899375 22:33885278-33885300 CCACTTTATTTCAAGCTGATATC 0: 1
1: 0
2: 1
3: 19
4: 198
Right 1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182899380 Original CRISPR TAGCTGACCCTCTGCGGAGG GGG Intronic
902101861 1:13996834-13996856 TGACTGTCCCTTTGCGGAGGGGG - Intergenic
902616422 1:17625909-17625931 TCGCTGACCCCCTGCAGAGAGGG - Intronic
903590529 1:24452520-24452542 TAGTTAACCCTCTGTGGAGTAGG - Intronic
920205125 1:204285915-204285937 TAGCTGACGCTTGGGGGAGGAGG + Intronic
920689425 1:208134636-208134658 TGGCTGAGCCTCTGGGGAGGAGG - Intronic
924569258 1:245223166-245223188 TAGCTGATTCTCTGTGGTGGGGG - Intronic
1065787410 10:29229527-29229549 TGGCTGATCCCCTGGGGAGGAGG + Intergenic
1067821953 10:49538671-49538693 CAGCTGACCCTGCGCGCAGGGGG + Intronic
1070676520 10:78415499-78415521 AAGAGGACCCTCTGCAGAGGAGG + Intergenic
1071669855 10:87598228-87598250 TAGCTGGCACTTTGGGGAGGTGG + Intergenic
1075469471 10:122677352-122677374 TTCCTGACTCTCTGCAGAGGAGG + Intergenic
1088881296 11:113975422-113975444 TGGCTGACCATCTGCTGAGGTGG + Intronic
1091097790 11:132840380-132840402 CAGCTGCCCCTTTGCTGAGGTGG + Intronic
1095584484 12:43835753-43835775 CAGCTGCCGCTCTGCAGAGGCGG + Intergenic
1103188452 12:118981113-118981135 TAGCTGATCTTCTGCGTGGGGGG - Intergenic
1110507234 13:76301155-76301177 TAGCTTACCCTCTCAAGAGGTGG - Intergenic
1119438367 14:74612279-74612301 GAGCTGTCCCTCCGAGGAGGGGG - Exonic
1122368535 14:101214014-101214036 TGGCTGACCCTGAGCTGAGGGGG + Intergenic
1127317198 15:57808297-57808319 TACCTGATCATCTGGGGAGGGGG + Intergenic
1129274029 15:74433775-74433797 TAGGTGGCCCTGGGCGGAGGCGG + Exonic
1131080633 15:89531704-89531726 TAGCAGGCCCTCTGAAGAGGAGG - Intergenic
1133978451 16:10617007-10617029 GAGCTGCCCCTCTGGGGAGGGGG + Intergenic
1137619225 16:49865584-49865606 TGGCTGAGACTCTGCTGAGGGGG + Intergenic
1141137402 16:81475070-81475092 TGGCTGGCCCTCTGGAGAGGAGG + Intronic
1141919425 16:87126088-87126110 CAGCTGCCCCTCTGCCGAGGAGG + Intronic
1144789572 17:17849934-17849956 AAGCTGACCTTCTGGGGAGGAGG + Intronic
1148319174 17:46735592-46735614 TAGCTGACCCTCAACAGAGTAGG - Intronic
1156781110 18:40852038-40852060 TAGATGACCCACTGAGGAGCTGG - Intergenic
1161552829 19:4923611-4923633 CAGCTGCCCCTCTGCGCACGTGG + Intronic
1164885038 19:31771277-31771299 AATCTGAGCCTCTGTGGAGGGGG - Intergenic
927445632 2:23158689-23158711 TAACTGACCCTCAGAGAAGGAGG + Intergenic
930429129 2:51251505-51251527 CAGCTGCCCCTCTGCTCAGGGGG - Intergenic
936502078 2:113074481-113074503 CTGCTGACCCTCTGCTGGGGAGG - Intronic
946168382 2:217879041-217879063 AAGCTGGCCCTCTGCCGAGAGGG + Intronic
1169737481 20:8852563-8852585 TAACTGACCCTCTACTGATGTGG - Intronic
1171567460 20:26208531-26208553 GAGCTGACTCGCGGCGGAGGGGG + Intergenic
1174401939 20:50280696-50280718 TATCTGACCCACTGCCCAGGAGG + Intergenic
1175167543 20:57055423-57055445 CAGCAGGCCCTCTGCAGAGGGGG + Intergenic
1178762092 21:35412736-35412758 GAGCAGATCCTCTGTGGAGGAGG + Intronic
1179256047 21:39716138-39716160 TAGTTGCACCACTGCGGAGGAGG + Intergenic
1179995724 21:44973280-44973302 GAGCTGAACCCCTGAGGAGGTGG - Intronic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1182338018 22:29598204-29598226 TAGCTGCCCCTCCGCGGAGAAGG - Intergenic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1185397736 22:50601170-50601192 GGGCCGACCCTCTGCGGGGGAGG + Intronic
949497215 3:4643957-4643979 AACCTGACCCTGTGCAGAGGGGG - Intronic
952827585 3:37537146-37537168 GACCTGAACCTCTGAGGAGGGGG + Intronic
953569252 3:44058223-44058245 TGGCTGTCCTTCTGAGGAGGAGG + Intergenic
954502200 3:51029335-51029357 TTGCTCACCCTCTGCGGGGCTGG + Intronic
958748439 3:98165396-98165418 TAGATGGCCCTCTGCCGGGGAGG - Intergenic
963614367 3:147517185-147517207 TACCTAAGCCTCTGCAGAGGTGG + Intergenic
967088574 3:186115759-186115781 CAGCAGAGCCTCAGCGGAGGTGG - Intronic
968496712 4:922086-922108 CAGATGACCCTATGCGGAGACGG + Intronic
969362987 4:6676996-6677018 GAGCTGACCATCTGAGGTGGTGG + Intergenic
969648375 4:8447607-8447629 TTCCTGAGCCTCTGAGGAGGTGG + Intronic
971533839 4:27722801-27722823 TTGCTGACCTTCTGTGTAGGTGG + Intergenic
977060712 4:92254548-92254570 TGGCTGTCCCTTTGTGGAGGGGG + Intergenic
979732773 4:124045055-124045077 TAGCTGCCCCTTGGCAGAGGGGG + Intergenic
986404384 5:7411288-7411310 TGGCTCACCCTCTGAGGTGGGGG + Intronic
991124383 5:63053059-63053081 TAGCTTACCTTCTGGGGAGCTGG - Intergenic
998638704 5:143985688-143985710 GAGCTGCCCCTCTGGGGAGATGG - Intergenic
1003177294 6:3761579-3761601 TAGCTGCCTCCCTGCGGAGCAGG + Intergenic
1004743981 6:18491677-18491699 GAGCTGAGCCCCTGTGGAGGGGG - Intergenic
1005224976 6:23632188-23632210 TGGCTGTCCCTCTGTGGGGGTGG + Intergenic
1005988875 6:30891219-30891241 AAGCTGTCACTCTGAGGAGGGGG + Intronic
1007375993 6:41457051-41457073 TGCCTGACCCTCTGGGGAGCTGG - Intergenic
1007401763 6:41606707-41606729 TGGCTGTCACTCTGGGGAGGGGG + Intergenic
1017622185 6:156310339-156310361 TAGCAGAGCCACTGCAGAGGTGG - Intergenic
1018715640 6:166530498-166530520 AAACTGACCCCCTGGGGAGGAGG - Intronic
1023868526 7:44250464-44250486 ATGCTGACTGTCTGCGGAGGGGG - Intronic
1024034335 7:45494965-45494987 TGGCTGCCCCTTTGTGGAGGGGG + Intergenic
1031604142 7:123748688-123748710 TTGGTGACCCTCCGCGGCGGCGG + Exonic
1031988320 7:128178374-128178396 TGGCTGGGCCTCTGCGGAGTGGG + Intergenic
1037611191 8:20477786-20477808 TAACTGTCCCTCTGCTCAGGAGG - Intergenic
1041521746 8:58764389-58764411 TAGATGACCCTCTAATGAGGTGG + Intergenic
1043011349 8:74885327-74885349 TTGCATTCCCTCTGCGGAGGAGG - Intergenic
1049814744 8:144592929-144592951 ATGCTGACCCTCTGTGGTGGAGG - Intronic
1051734645 9:20186082-20186104 TAGCTCACTTTCTGAGGAGGGGG + Intergenic
1058061163 9:100497553-100497575 TAGCTCACCCTCCGAGGAGCTGG - Intronic
1059262655 9:112993563-112993585 TAGCTGCCCCTTGGCAGAGGAGG + Intergenic
1062167667 9:135116051-135116073 TAGCTTCCTCTCTGGGGAGGCGG - Intronic
1190115005 X:47620433-47620455 TAGCTGAGCCTGTGTGGATGTGG - Intergenic
1195460255 X:105115890-105115912 TAGCTGCCTCTCTGCGGGGCAGG - Intronic
1195721359 X:107872043-107872065 TAGATGAGCCTCTTCAGAGGAGG - Intronic
1198333358 X:135642808-135642830 TAGCTGTCCCTCTGGGGGGAGGG - Intergenic
1200213499 X:154357196-154357218 AAGCTGCCCCTCTGGGCAGGAGG + Intronic