ID: 1182900493

View in Genome Browser
Species Human (GRCh38)
Location 22:33894396-33894418
Sequence GCCACCCTAGTGAGTAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182900493 Original CRISPR GCCACCCTAGTGAGTAGAGT AGG (reversed) Intronic
900731876 1:4267464-4267486 CCCAGCCTAGTGAGCAAAGTGGG - Intergenic
905199684 1:36307333-36307355 GCCTCCCTAGTGAGCGGGGTGGG + Intronic
914352945 1:146856057-146856079 GTCACACAAGTGAATAGAGTGGG + Intergenic
919810847 1:201408100-201408122 GCCACTCTAGTGAGTATGTTGGG + Exonic
1065962269 10:30743397-30743419 GCCCTCCTAGTGAATACAGTAGG - Intergenic
1074288249 10:112118802-112118824 GCCACCCTAGTGGGTAGGAAGGG + Intergenic
1075240496 10:120774179-120774201 GCCACACAAGTGAGTAAAGTAGG + Intergenic
1083797548 11:65026089-65026111 GCCACCCTAAAGAGGAGAGATGG - Intronic
1084768182 11:71325827-71325849 CCCACCCTCGTGAGCAGAGCGGG - Intergenic
1084987190 11:72885862-72885884 GCCACCATAGTGAGGAGGGCAGG - Intronic
1087647946 11:100829576-100829598 GCCACCCTAGGGGGCAGAGGAGG - Intronic
1091594716 12:1869482-1869504 GCCATCCTGATGGGTAGAGTTGG + Intronic
1096814266 12:54191765-54191787 GCAGCCCAAGTGAGCAGAGTCGG - Intergenic
1102111201 12:110366757-110366779 GCCCTCCTAGTGAGGAGGGTGGG + Intergenic
1106048815 13:26170821-26170843 GCCACACTTGTAAGTAGTGTGGG + Intronic
1107346406 13:39466058-39466080 GCCAGCCTTTGGAGTAGAGTGGG + Intronic
1118952838 14:70450061-70450083 ACCACCCCAGTGAGTGGGGTGGG + Intergenic
1124626722 15:31311994-31312016 GCAACCCTGGTCAGCAGAGTGGG - Intergenic
1125719265 15:41837366-41837388 GCCACACAGGTGAGCAGAGTGGG + Exonic
1133980900 16:10632646-10632668 GGGACCCTAGTGATTGGAGTAGG + Intronic
1136003947 16:27315558-27315580 GCTAGCCTTGTGAGTAGAGCAGG + Intronic
1139981080 16:70859461-70859483 GTCACACAAGTGAATAGAGTGGG - Intronic
1142996441 17:3763374-3763396 GCCACCCTAGTAACTAGCATGGG - Intronic
1149334664 17:55623270-55623292 GGCACTCTAGTGTGCAGAGTAGG - Intergenic
1165443130 19:35842238-35842260 GCCACCTTAGTTAGGGGAGTGGG + Exonic
925439603 2:3873141-3873163 GCTATTCTTGTGAGTAGAGTAGG - Intergenic
931648799 2:64450277-64450299 GCCACACCAGAGAGAAGAGTGGG + Intergenic
937140948 2:119599671-119599693 GCCCCCCTTGTGAGGAGAGGTGG - Intronic
937520427 2:122707137-122707159 GCCAGCCAAGTGAGGAGAATGGG - Intergenic
947762938 2:232616979-232617001 GCGACCCTAGTGAGTAGGGCTGG + Intronic
948173249 2:235923522-235923544 GTCACCCTTGTGAGTGGGGTGGG - Intronic
1169698176 20:8415513-8415535 GGTACCATAGTGAGTGGAGTAGG + Intronic
1173846012 20:46189228-46189250 GCCACTCCAGTGATTAGAGGGGG + Intronic
1174075189 20:47930185-47930207 GCCACCCAGGTGAGTAGACTGGG + Intergenic
1177118856 21:17117786-17117808 ACCACACTTGTGAGAAGAGTTGG - Intergenic
1177869893 21:26558514-26558536 GTCACCCTAGGGAGGAGTGTTGG - Intronic
1181043680 22:20204695-20204717 GTCTCCCCTGTGAGTAGAGTCGG + Intergenic
1181067226 22:20312649-20312671 GCCTCCCCAGGGAGAAGAGTAGG + Intergenic
1182298736 22:29326536-29326558 GCCACCCGGGTGAGGAGAGCTGG - Intergenic
1182900493 22:33894396-33894418 GCCACCCTAGTGAGTAGAGTAGG - Intronic
1184143046 22:42590493-42590515 GTTACTCTACTGAGTAGAGTAGG + Intronic
1184615187 22:45633169-45633191 GCCACCTTAGTGTGTAGTGCAGG + Intergenic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
961760091 3:129160959-129160981 GACACCATGGTGAGTAGGGTGGG - Exonic
973296370 4:48526410-48526432 ACCACTCTAGTGAATAGAATAGG - Intronic
973882383 4:55286918-55286940 GCCACACTAAAAAGTAGAGTAGG - Intergenic
987689287 5:21245781-21245803 GGTACCCTGGTGAGAAGAGTGGG - Intergenic
991097013 5:62750290-62750312 TCCACCCTTGTGAGTGGGGTTGG + Intergenic
993042813 5:82835120-82835142 GGCACACTGGTGAGAAGAGTGGG + Intergenic
996395213 5:123006677-123006699 GCCAACATAGTGAGAAAAGTGGG - Intronic
1001560592 5:172666545-172666567 GCCACCCTAGTATCTAGAGTTGG + Intronic
1008420299 6:51291579-51291601 GACACCTGAGTGAGTGGAGTTGG + Intergenic
1011590342 6:88965148-88965170 TCCACAATAGAGAGTAGAGTAGG + Intergenic
1014189668 6:118479622-118479644 GCCACTCTAGTGGGGTGAGTTGG - Intronic
1014637319 6:123863634-123863656 GGCACCATTGGGAGTAGAGTTGG + Intronic
1019416367 7:928662-928684 GCCATCCTAGTGGGGAGAGGTGG - Intronic
1024164398 7:46715629-46715651 GCCACCCTGGGGAGGAGAGAAGG + Intronic
1026325047 7:69301849-69301871 GCTACCCTATGGAGTAGGGTAGG - Intergenic
1029498739 7:100914312-100914334 GCCACCCTAGGCGGTGGAGTGGG + Intergenic
1031634826 7:124090117-124090139 GCTACCCTAGTAAGTAAAGGAGG + Intergenic
1043711699 8:83426999-83427021 GCCATACTAGTGAATAGAGCCGG + Intergenic
1050358235 9:4803692-4803714 GCCTCCCCAGTGAGAAGAGGAGG - Intronic
1051101447 9:13526921-13526943 ACCACAATAGTGAGCAGAGTTGG - Intergenic
1056923823 9:90815334-90815356 GGCACCCCAGTGAGCAGAGGTGG + Intronic
1058108452 9:101002795-101002817 GCAAACCAAGTGAGTAGTGTTGG - Intergenic
1186009394 X:5112358-5112380 TCCATCCTAGTGAGTAGAAGTGG - Intergenic
1194011785 X:88570429-88570451 GCCTCCCTAGGAAGTAAAGTAGG - Intergenic
1197316840 X:124977019-124977041 GCTACCATAGAGAGTAGGGTTGG + Intergenic
1201671176 Y:16522364-16522386 TCCATCCTAGTGAGTAGAAATGG + Intergenic