ID: 1182904000

View in Genome Browser
Species Human (GRCh38)
Location 22:33920891-33920913
Sequence CCCGCGCGGCGGCCCACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 160}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182904000_1182904016 13 Left 1182904000 22:33920891-33920913 CCAGGAGTGGGCCGCCGCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1182904016 22:33920927-33920949 GGGCGCTGGGGTCCGGGCTCCGG 0: 1
1: 0
2: 4
3: 64
4: 544
1182904000_1182904008 -8 Left 1182904000 22:33920891-33920913 CCAGGAGTGGGCCGCCGCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1182904008 22:33920906-33920928 CGCGCGGGAACCGGCAGGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 159
1182904000_1182904010 -1 Left 1182904000 22:33920891-33920913 CCAGGAGTGGGCCGCCGCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1182904010 22:33920913-33920935 GAACCGGCAGGGGCGGGCGCTGG 0: 1
1: 0
2: 0
3: 30
4: 318
1182904000_1182904011 0 Left 1182904000 22:33920891-33920913 CCAGGAGTGGGCCGCCGCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1182904011 22:33920914-33920936 AACCGGCAGGGGCGGGCGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 134
1182904000_1182904015 7 Left 1182904000 22:33920891-33920913 CCAGGAGTGGGCCGCCGCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1182904015 22:33920921-33920943 AGGGGCGGGCGCTGGGGTCCGGG 0: 1
1: 0
2: 3
3: 84
4: 676
1182904000_1182904018 18 Left 1182904000 22:33920891-33920913 CCAGGAGTGGGCCGCCGCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1182904018 22:33920932-33920954 CTGGGGTCCGGGCTCCGGGCTGG 0: 1
1: 0
2: 4
3: 55
4: 458
1182904000_1182904009 -7 Left 1182904000 22:33920891-33920913 CCAGGAGTGGGCCGCCGCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1182904009 22:33920907-33920929 GCGCGGGAACCGGCAGGGGCGGG 0: 1
1: 0
2: 2
3: 20
4: 343
1182904000_1182904012 1 Left 1182904000 22:33920891-33920913 CCAGGAGTGGGCCGCCGCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1182904012 22:33920915-33920937 ACCGGCAGGGGCGGGCGCTGGGG 0: 1
1: 0
2: 2
3: 45
4: 449
1182904000_1182904017 14 Left 1182904000 22:33920891-33920913 CCAGGAGTGGGCCGCCGCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1182904017 22:33920928-33920950 GGCGCTGGGGTCCGGGCTCCGGG 0: 1
1: 0
2: 9
3: 88
4: 604
1182904000_1182904014 6 Left 1182904000 22:33920891-33920913 CCAGGAGTGGGCCGCCGCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1182904014 22:33920920-33920942 CAGGGGCGGGCGCTGGGGTCCGG 0: 1
1: 0
2: 3
3: 69
4: 874

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182904000 Original CRISPR CCCGCGCGGCGGCCCACTCC TGG (reversed) Intronic
900155881 1:1203116-1203138 CCCGCCCAGCCTCCCACTCCAGG - Intergenic
900413904 1:2526392-2526414 CCCGCTCGCCGGCCCACCGCCGG + Intronic
900988017 1:6084537-6084559 CCGGCGCGGTGGCTCACGCCTGG + Intronic
901361319 1:8703264-8703286 CCCGCGCGGCCACCGCCTCCCGG - Intronic
905867121 1:41382414-41382436 CCCGCCCGGCGGCCTCCTGCTGG + Exonic
912827891 1:112923336-112923358 GCCACGCGGCCGCCAACTCCAGG + Intronic
913600224 1:120415191-120415213 GCCGCGCCTCGGCCCGCTCCTGG - Intergenic
914192736 1:145425416-145425438 GCCGCGCCTCGGCCCGCTCCTGG + Intergenic
914590642 1:149103364-149103386 GCCGCGCCTCGGCCCGCTCCTGG + Exonic
919727045 1:200891307-200891329 CCCGCGCGGTGGGACACCCCTGG - Intronic
920528576 1:206685582-206685604 CCCGCGCCGCGACCCAGGCCGGG - Intronic
922648613 1:227318111-227318133 CCGGCGCGGCGGCCCGGTGCGGG - Exonic
923576238 1:235161319-235161341 GCCGCCCGGCGGCCGACTGCCGG - Exonic
1063664522 10:8053512-8053534 CCCGCGGGGCGGACCAATCGCGG + Intergenic
1069018949 10:63465151-63465173 CCCGCGCGGCGCCGGACTCGCGG + Intronic
1076639009 10:131901337-131901359 CCCGCGCCGCGCCCCGCCCCGGG + Intronic
1076648530 10:131971138-131971160 CCCGGGCCGCGCCGCACTCCCGG + Intronic
1077076890 11:706094-706116 CCCGCGCGCCCGCCCGCTCTCGG + Intronic
1077141675 11:1027545-1027567 CCCTCCCGGCCGCCCCCTCCCGG - Intronic
1077381003 11:2237510-2237532 CCGGCGTGGCGGCTCACGCCTGG - Intergenic
1083289223 11:61680518-61680540 CCGGCGCGGCGGGCCGGTCCTGG + Intronic
1084588711 11:70078334-70078356 CCCGCGGGCCGGCCCGCGCCTGG - Exonic
1091915410 12:4269478-4269500 GCCGCCCAGCGGCCCCCTCCCGG + Intergenic
1096139936 12:49234550-49234572 CCCGCGTGGCGCCGCAGTCCTGG + Intronic
1097127790 12:56789056-56789078 CCCGCCCGGCCGCCCCGTCCGGG - Intergenic
1097262430 12:57727120-57727142 CCTGCACGGCGGCCCACAGCTGG + Exonic
1104065209 12:125300029-125300051 CCCCCGTGGCGGCCCACGCAGGG - Intronic
1107481618 13:40789987-40790009 CCTGCCCAGCCGCCCACTCCTGG - Intronic
1108220944 13:48233085-48233107 CCCGCGCAGCACCCCACCCCCGG + Intergenic
1110637047 13:77778483-77778505 CCGGCGCGGGGGCTCACGCCTGG - Intergenic
1112088170 13:96053391-96053413 GCTGCGCGGCTGCCCACTTCCGG + Intronic
1112272077 13:97977054-97977076 CCCGCCCGGCACCCCACACCTGG - Intronic
1112752581 13:102597294-102597316 CCCGCTCTGCGGCCGAGTCCGGG + Intronic
1114231424 14:20786243-20786265 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1119219403 14:72893702-72893724 CCCGCGAGGCGGGGGACTCCGGG + Intronic
1120521760 14:85533422-85533444 CCCGCGCAGCGCCGCACGCCCGG + Intronic
1122065972 14:99174797-99174819 CCCGCGCCGCTGCCCAGCCCCGG - Exonic
1122905796 14:104800888-104800910 CCCGGGCGGCCGCCCGCTCGCGG - Intronic
1124426808 15:29570070-29570092 CCCTCGCGGCGGCCCTGACCGGG - Intronic
1126348354 15:47718815-47718837 CGCGAGCGGCGGCTCCCTCCCGG - Exonic
1127118777 15:55753322-55753344 CAAGCGCAGCGGCCCACGCCTGG + Intergenic
1128149643 15:65355178-65355200 CCCCCGCGGGGCCCCACTGCAGG + Intronic
1129659040 15:77542904-77542926 CCCGCGGGGCTCCCCACCCCGGG + Intergenic
1129763976 15:78149501-78149523 CCCACGCGCCCGCCCACACCCGG - Intronic
1131253342 15:90845262-90845284 CCCACACGGAGCCCCACTCCAGG + Intergenic
1132186876 15:99807843-99807865 CCGGCGCGGTGGCTCACGCCTGG - Intergenic
1132428813 15:101744875-101744897 CCGGCGCGGTGGCTCACGCCTGG + Intronic
1133188694 16:4117274-4117296 CCAGCGCCGGGGCCCACACCAGG + Intergenic
1134199620 16:12187281-12187303 TGGGCGCGGTGGCCCACTCCTGG + Intronic
1134441631 16:14302438-14302460 CCCGCGGGGCGCCCCCCGCCCGG + Intergenic
1139750400 16:69106339-69106361 CCCGCGCGGCCCTCCCCTCCTGG - Intronic
1140223002 16:73057927-73057949 CCCGCGCGGCTGCTCAGCCCGGG + Intronic
1141972491 16:87492878-87492900 CCCGCGCGGCGGACGGATCCGGG + Intergenic
1142006041 16:87689998-87690020 CCTGCGCGGCGGCCTGCTCGTGG + Exonic
1142429723 16:90019517-90019539 CCCGGGCCCCGGCCCCCTCCCGG + Intronic
1142572865 17:886498-886520 CCGGCGCGGTGGCTCACGCCAGG + Intronic
1143319395 17:6058367-6058389 CCAGCGCGGTGGCCCAGGCCAGG + Intronic
1143541735 17:7573239-7573261 CCCGCGCGCCGTCCCTCCCCCGG - Intronic
1147720408 17:42536350-42536372 CCCGCACGGCCGCCGCCTCCCGG - Exonic
1147989735 17:44325338-44325360 CCGGCGCGGCGGCTCACGCCTGG - Intergenic
1148878576 17:50707725-50707747 CCGTCGCCGCGGCCCGCTCCCGG + Exonic
1150250029 17:63700036-63700058 CCCGCCCCGCGGCCCAGGCCGGG - Exonic
1151756326 17:76077227-76077249 CCCGCGCGGCAGCGCACACACGG - Exonic
1151906755 17:77053983-77054005 CCCCTGGGGCTGCCCACTCCAGG - Intergenic
1152660620 17:81540289-81540311 CCTGCCCGGCTGCCCACTCTGGG - Exonic
1160887087 19:1355096-1355118 CCAGCGCGGCGCCCCAAGCCCGG - Intronic
1161104511 19:2436768-2436790 CCCCCACGGCCGCCCTCTCCAGG + Intronic
1161325744 19:3663140-3663162 CGGGCGCGGAGGCTCACTCCTGG - Intronic
1161397832 19:4054227-4054249 CCCCCGCCGCGGCCCCCGCCCGG + Exonic
1161488321 19:4547868-4547890 CCCGCGGGCAGGACCACTCCTGG - Intronic
1163282425 19:16325681-16325703 CCCGCGCGCCTGCCCGCGCCCGG + Exonic
1165129239 19:33621891-33621913 CCCGCCCGGCGCCCCGCCCCCGG - Intergenic
1166107739 19:40605678-40605700 CCCGCGCGGAGGCAAGCTCCGGG - Intronic
1166304074 19:41927963-41927985 CCCCCGCGCCCGCCCCCTCCTGG + Intronic
1167181127 19:47904264-47904286 CGGGCGCGGTGGCTCACTCCTGG + Intergenic
1167181795 19:47909624-47909646 CGGGCGCGGCGGCTCACTCCTGG + Intergenic
1167182444 19:47915014-47915036 CGGGCGCGGCGGCTCACTCCTGG + Intergenic
1167183112 19:47920366-47920388 CGGGCGCGGTGGCTCACTCCTGG + Intergenic
1167183780 19:47925716-47925738 CGGGCGCGGCGGCTCACTCCTGG + Intergenic
1167184409 19:47930766-47930788 CGGGCGCGGCGGCTCACTCCTGG + Intergenic
1167185081 19:47936117-47936139 CGGGCGCGGCGGCTCACTCCTGG + Intergenic
1167185734 19:47941506-47941528 CGGGCGCGGTGGCTCACTCCTGG + Intergenic
1167186401 19:47946861-47946883 CGGGCGCGGTGGCTCACTCCTGG + Intergenic
1167187052 19:47952252-47952274 CGGGCGCGGTGGCTCACTCCTGG + Intergenic
1167187702 19:47957635-47957657 CGGGCGCGGTGGCTCACTCCTGG + Intergenic
1167258003 19:48442687-48442709 CCCGCGCCGCGGCCGGCTCCCGG + Exonic
1167542139 19:50095997-50096019 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167543011 19:50102127-50102149 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167543447 19:50105190-50105212 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167544120 19:50110534-50110556 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167544795 19:50115887-50115909 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167545470 19:50121239-50121261 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167546147 19:50126594-50126616 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167546824 19:50131929-50131951 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167547482 19:50137302-50137324 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167621248 19:50562234-50562256 CCTGCAGGGCGGCCCACACCAGG + Intronic
925684892 2:6459715-6459737 CCCTGGCTGCGGGCCACTCCTGG + Intergenic
932812659 2:74837317-74837339 CCCGGGCCTCTGCCCACTCCTGG + Intronic
938299114 2:130197882-130197904 CAGGCGCGGCGGCTCACGCCTGG - Intronic
938457608 2:131476655-131476677 CAGGCGCGGCGGCTCACGCCTGG + Intronic
942454739 2:176130064-176130086 CCCGCGCGCCGCCGCCCTCCCGG - Exonic
942459773 2:176160755-176160777 CCCGCGCCCCCACCCACTCCTGG - Intronic
942702542 2:178730022-178730044 CCCCCGCCCCGGCCCACCCCAGG + Intronic
943669799 2:190648866-190648888 GCCCGGCGGCGGCCCACGCCGGG + Intronic
944547499 2:200812203-200812225 CCAGCGCCGCGGCGCACACCCGG - Intronic
947860583 2:233354749-233354771 CCCGAGCGGCCGCCCAGGCCCGG + Intronic
948467457 2:238159126-238159148 CCCGGGCGGCGGCTCCCTGCGGG - Exonic
948468647 2:238163996-238164018 CCCGCGCGCCGGCACTCACCAGG - Exonic
1173251593 20:41366660-41366682 CCCGCGCGGTGCCCCCCGCCGGG + Exonic
1173807419 20:45934946-45934968 CCGGCGCGGCCGCCCACCCGCGG - Intronic
1174007990 20:47425861-47425883 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1176131604 20:63498875-63498897 CCCGCGCCGCCCCCCACCCCGGG + Intronic
1176135616 20:63520891-63520913 CGCGCGCGGCGCCCCTCACCTGG - Exonic
1177880637 21:26690103-26690125 CCCGCCCGGCAGCCTACTCTGGG - Intergenic
1180226749 21:46398010-46398032 CCCGCTCGGCTGCCTGCTCCTGG - Exonic
1180235922 21:46459273-46459295 CCCGCGCAGCCCCTCACTCCGGG + Intronic
1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG + Intronic
1180236044 21:46459566-46459588 CCCGCGCGGCCCCTCACCCCGGG + Intronic
1181998433 22:26901602-26901624 CCGGCGCGGTGGCTCACGCCTGG + Intergenic
1182904000 22:33920891-33920913 CCCGCGCGGCGGCCCACTCCTGG - Intronic
1184152360 22:42646462-42646484 CCTGCGCAGCTGCCCACCCCTGG + Intronic
1184523017 22:45007160-45007182 CCAGCCCGGCGGCCCAGACCAGG + Intronic
1184766961 22:46577156-46577178 CCCGCGGGGCCGCCTCCTCCCGG + Intronic
950710583 3:14810644-14810666 CCCGCCCGGCGGCCCCGCCCCGG + Intergenic
953326142 3:42013799-42013821 CCCGCGCGCGGCCCCACTCTGGG - Intronic
954615653 3:51967631-51967653 CCCGAGCGGCGGCCGCTTCCTGG + Intronic
962222472 3:133574521-133574543 CCCGGGCGGCGCCACCCTCCGGG + Intronic
963904573 3:150763070-150763092 CCCGCGCGGTGCCCTCCTCCCGG + Exonic
966936341 3:184712044-184712066 CCCGCGCGAGGGGCCACTTCCGG + Intergenic
967952005 3:194848321-194848343 CGGGCGCGGCGGCTCACACCTGG + Intergenic
968082210 3:195854350-195854372 CGGGCGCGGCGGCTCACGCCTGG + Intergenic
968461232 4:726047-726069 CGCCCGCGGCTGCCCACTGCTGG - Intronic
968515750 4:1014991-1015013 CCCGCGCTGCGGCCCTGTCAGGG + Intronic
970394968 4:15655940-15655962 CCCGGGCGGCAGCCCACAGCGGG + Intronic
985334164 4:188873513-188873535 CCGGCGCGGGGGCTCACGCCTGG + Intergenic
986504830 5:8438970-8438992 CCAGAGAGGCGGCCCAGTCCTGG - Intergenic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
998041778 5:138955077-138955099 CCAGAGCTGCGGCCCACCCCTGG + Intronic
1001628282 5:173155422-173155444 CCAGTGCGGCGGCTCACGCCTGG + Intronic
1002098988 5:176848108-176848130 CCCACGCTGCGGCCTCCTCCAGG + Intronic
1010366452 6:75057560-75057582 CCCTCCCTGCAGCCCACTCCAGG - Intergenic
1019774114 7:2902117-2902139 GCCGTGCGGTGGCTCACTCCTGG + Intergenic
1026091326 7:67302932-67302954 CACGCGCGGCGGCCGGCTGCTGG + Intergenic
1029399748 7:100336369-100336391 CACGCGCGGCGGCCCGTTGCTGG + Intronic
1029640466 7:101816541-101816563 GCCGGGCCGCGGCCCCCTCCCGG - Intronic
1032119328 7:129144994-129145016 CCCGGGCGCCGGCCGCCTCCGGG + Exonic
1035230112 7:157460201-157460223 CCCAGGCTGCGGCCCACACCTGG - Intergenic
1039875104 8:41578351-41578373 CCCGCGCGGCCGCCCAAGCCCGG - Intronic
1040471525 8:47738539-47738561 CGCGCGCTGCGGCCAAGTCCTGG - Exonic
1045583054 8:103500206-103500228 CCGGCCCCGCGGCCCGCTCCCGG + Intergenic
1048981210 8:139704034-139704056 CCAGCGCGGCGGCCGCCTCCCGG - Intergenic
1049441710 8:142612629-142612651 CCGGCGCCGCCGCCCTCTCCCGG - Exonic
1049843202 8:144787245-144787267 CCCGCGCGCCCGCCCCCGCCGGG + Intronic
1050472618 9:6008213-6008235 CCGCCGCTGCGGCCCCCTCCGGG - Intergenic
1051774499 9:20620509-20620531 CCCGCGCGGCGCCGCGCACCCGG + Intronic
1054175038 9:61869158-61869180 GCCGCGCGGCGGGCCTGTCCGGG + Intergenic
1054662499 9:67711635-67711657 GCCGCGCGGCGGGCCAGTCCGGG - Intergenic
1056732492 9:89178175-89178197 GCCGCGCGCCCGCCCGCTCCCGG + Exonic
1057786072 9:98088046-98088068 CCAGCGCGGCGCCCCGCCCCCGG + Intronic
1062403321 9:136381948-136381970 CCAGCGCCGCTGCCCACTCTGGG + Exonic
1062483367 9:136762623-136762645 CCGGCGCGGTGGCTCACGCCTGG + Intronic
1062503606 9:136861761-136861783 TCCCCCCGGCAGCCCACTCCCGG + Intronic
1062593127 9:137283578-137283600 CAGGCGCGGCGGCTCACGCCTGG - Intergenic
1062718649 9:138023512-138023534 CCCGCTCGGCCGCCTCCTCCGGG - Exonic
1186466359 X:9786743-9786765 CCCGCAGGGCGGCCAGCTCCCGG - Intronic
1189446660 X:41086265-41086287 CCCGCGCGCCCGCCCAGCCCGGG - Intronic
1190308693 X:49101596-49101618 CGCGCGCGGCAGGCCATTCCAGG + Intergenic
1192847792 X:74924446-74924468 CCCACGCGGCGGCCGAGGCCGGG - Intronic
1198321448 X:135521740-135521762 CCCGCGCGGCGACCCTCGCGCGG - Intronic
1199772545 X:150983880-150983902 CCCGTGCGGCGGCCCCCGGCGGG - Intronic
1200091477 X:153638132-153638154 CCCACGCGGCGCCCCTGTCCTGG + Intergenic
1200222609 X:154398636-154398658 CCCGTGCGGCGGCCCTGTCTTGG + Intronic