ID: 1182920461

View in Genome Browser
Species Human (GRCh38)
Location 22:34074527-34074549
Sequence TCAGGTGCGCCCAGGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182920454_1182920461 2 Left 1182920454 22:34074502-34074524 CCCACAAACACTGAGCACTCCAG No data
Right 1182920461 22:34074527-34074549 TCAGGTGCGCCCAGGTGCTGGGG No data
1182920453_1182920461 17 Left 1182920453 22:34074487-34074509 CCTTCAATTAGTTATCCCACAAA No data
Right 1182920461 22:34074527-34074549 TCAGGTGCGCCCAGGTGCTGGGG No data
1182920455_1182920461 1 Left 1182920455 22:34074503-34074525 CCACAAACACTGAGCACTCCAGT No data
Right 1182920461 22:34074527-34074549 TCAGGTGCGCCCAGGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182920461 Original CRISPR TCAGGTGCGCCCAGGTGCTG GGG Intergenic
No off target data available for this crispr