ID: 1182925759

View in Genome Browser
Species Human (GRCh38)
Location 22:34123106-34123128
Sequence CTTCCCCAATTTGTAAAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182925759_1182925762 -10 Left 1182925759 22:34123106-34123128 CCCTATTTTACAAATTGGGGAAG No data
Right 1182925762 22:34123119-34123141 ATTGGGGAAGCGAGGCAAAGAGG No data
1182925759_1182925764 -8 Left 1182925759 22:34123106-34123128 CCCTATTTTACAAATTGGGGAAG No data
Right 1182925764 22:34123121-34123143 TGGGGAAGCGAGGCAAAGAGGGG No data
1182925759_1182925763 -9 Left 1182925759 22:34123106-34123128 CCCTATTTTACAAATTGGGGAAG No data
Right 1182925763 22:34123120-34123142 TTGGGGAAGCGAGGCAAAGAGGG No data
1182925759_1182925765 20 Left 1182925759 22:34123106-34123128 CCCTATTTTACAAATTGGGGAAG No data
Right 1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182925759 Original CRISPR CTTCCCCAATTTGTAAAATA GGG (reversed) Intergenic
No off target data available for this crispr