ID: 1182925760

View in Genome Browser
Species Human (GRCh38)
Location 22:34123107-34123129
Sequence GCTTCCCCAATTTGTAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182925760_1182925765 19 Left 1182925760 22:34123107-34123129 CCTATTTTACAAATTGGGGAAGC No data
Right 1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG No data
1182925760_1182925763 -10 Left 1182925760 22:34123107-34123129 CCTATTTTACAAATTGGGGAAGC No data
Right 1182925763 22:34123120-34123142 TTGGGGAAGCGAGGCAAAGAGGG No data
1182925760_1182925764 -9 Left 1182925760 22:34123107-34123129 CCTATTTTACAAATTGGGGAAGC No data
Right 1182925764 22:34123121-34123143 TGGGGAAGCGAGGCAAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182925760 Original CRISPR GCTTCCCCAATTTGTAAAAT AGG (reversed) Intergenic
No off target data available for this crispr