ID: 1182925762

View in Genome Browser
Species Human (GRCh38)
Location 22:34123119-34123141
Sequence ATTGGGGAAGCGAGGCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182925759_1182925762 -10 Left 1182925759 22:34123106-34123128 CCCTATTTTACAAATTGGGGAAG No data
Right 1182925762 22:34123119-34123141 ATTGGGGAAGCGAGGCAAAGAGG No data
1182925755_1182925762 24 Left 1182925755 22:34123072-34123094 CCTCACAAAAACTCTATGAGGTT No data
Right 1182925762 22:34123119-34123141 ATTGGGGAAGCGAGGCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182925762 Original CRISPR ATTGGGGAAGCGAGGCAAAG AGG Intergenic
No off target data available for this crispr