ID: 1182925765

View in Genome Browser
Species Human (GRCh38)
Location 22:34123149-34123171
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182925759_1182925765 20 Left 1182925759 22:34123106-34123128 CCCTATTTTACAAATTGGGGAAG No data
Right 1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG No data
1182925760_1182925765 19 Left 1182925760 22:34123107-34123129 CCTATTTTACAAATTGGGGAAGC No data
Right 1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182925765 Original CRISPR GTGACTTGCTCAAGATCACA CGG Intergenic