ID: 1182931479

View in Genome Browser
Species Human (GRCh38)
Location 22:34178311-34178333
Sequence AAGGAGAAGGAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182931479_1182931489 26 Left 1182931479 22:34178311-34178333 CCCTCCTCCTCCTCCTTCTCCTT No data
Right 1182931489 22:34178360-34178382 TCTCACTGTGTTGCCCAGGCTGG 0: 3138
1: 40460
2: 101153
3: 213792
4: 342817
1182931479_1182931488 22 Left 1182931479 22:34178311-34178333 CCCTCCTCCTCCTCCTTCTCCTT No data
Right 1182931488 22:34178356-34178378 GAAGTCTCACTGTGTTGCCCAGG 0: 69
1: 1715
2: 17565
3: 63817
4: 148934

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182931479 Original CRISPR AAGGAGAAGGAGGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr