ID: 1182932915

View in Genome Browser
Species Human (GRCh38)
Location 22:34192030-34192052
Sequence GAAACAAATGACTGCAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182932915_1182932920 15 Left 1182932915 22:34192030-34192052 CCAACTTTGCAGTCATTTGTTTC No data
Right 1182932920 22:34192068-34192090 CTTGTACAGTCACAGAAGTGTGG No data
1182932915_1182932921 16 Left 1182932915 22:34192030-34192052 CCAACTTTGCAGTCATTTGTTTC No data
Right 1182932921 22:34192069-34192091 TTGTACAGTCACAGAAGTGTGGG No data
1182932915_1182932926 30 Left 1182932915 22:34192030-34192052 CCAACTTTGCAGTCATTTGTTTC No data
Right 1182932926 22:34192083-34192105 AAGTGTGGGCTGGGTGGTCAGGG No data
1182932915_1182932925 29 Left 1182932915 22:34192030-34192052 CCAACTTTGCAGTCATTTGTTTC No data
Right 1182932925 22:34192082-34192104 GAAGTGTGGGCTGGGTGGTCAGG No data
1182932915_1182932924 24 Left 1182932915 22:34192030-34192052 CCAACTTTGCAGTCATTTGTTTC No data
Right 1182932924 22:34192077-34192099 TCACAGAAGTGTGGGCTGGGTGG No data
1182932915_1182932922 20 Left 1182932915 22:34192030-34192052 CCAACTTTGCAGTCATTTGTTTC No data
Right 1182932922 22:34192073-34192095 ACAGTCACAGAAGTGTGGGCTGG No data
1182932915_1182932923 21 Left 1182932915 22:34192030-34192052 CCAACTTTGCAGTCATTTGTTTC No data
Right 1182932923 22:34192074-34192096 CAGTCACAGAAGTGTGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182932915 Original CRISPR GAAACAAATGACTGCAAAGT TGG (reversed) Intergenic
No off target data available for this crispr