ID: 1182932917

View in Genome Browser
Species Human (GRCh38)
Location 22:34192058-34192080
Sequence GTGACTGTACAAGTTTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182932917_1182932926 2 Left 1182932917 22:34192058-34192080 CCCCAGGAAACTTGTACAGTCAC No data
Right 1182932926 22:34192083-34192105 AAGTGTGGGCTGGGTGGTCAGGG No data
1182932917_1182932923 -7 Left 1182932917 22:34192058-34192080 CCCCAGGAAACTTGTACAGTCAC No data
Right 1182932923 22:34192074-34192096 CAGTCACAGAAGTGTGGGCTGGG No data
1182932917_1182932922 -8 Left 1182932917 22:34192058-34192080 CCCCAGGAAACTTGTACAGTCAC No data
Right 1182932922 22:34192073-34192095 ACAGTCACAGAAGTGTGGGCTGG No data
1182932917_1182932924 -4 Left 1182932917 22:34192058-34192080 CCCCAGGAAACTTGTACAGTCAC No data
Right 1182932924 22:34192077-34192099 TCACAGAAGTGTGGGCTGGGTGG No data
1182932917_1182932927 30 Left 1182932917 22:34192058-34192080 CCCCAGGAAACTTGTACAGTCAC No data
Right 1182932927 22:34192111-34192133 CTCTCTGAGTAAGTAACATTTGG No data
1182932917_1182932925 1 Left 1182932917 22:34192058-34192080 CCCCAGGAAACTTGTACAGTCAC No data
Right 1182932925 22:34192082-34192104 GAAGTGTGGGCTGGGTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182932917 Original CRISPR GTGACTGTACAAGTTTCCTG GGG (reversed) Intergenic
No off target data available for this crispr