ID: 1182932925

View in Genome Browser
Species Human (GRCh38)
Location 22:34192082-34192104
Sequence GAAGTGTGGGCTGGGTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182932919_1182932925 -1 Left 1182932919 22:34192060-34192082 CCAGGAAACTTGTACAGTCACAG No data
Right 1182932925 22:34192082-34192104 GAAGTGTGGGCTGGGTGGTCAGG No data
1182932917_1182932925 1 Left 1182932917 22:34192058-34192080 CCCCAGGAAACTTGTACAGTCAC No data
Right 1182932925 22:34192082-34192104 GAAGTGTGGGCTGGGTGGTCAGG No data
1182932915_1182932925 29 Left 1182932915 22:34192030-34192052 CCAACTTTGCAGTCATTTGTTTC No data
Right 1182932925 22:34192082-34192104 GAAGTGTGGGCTGGGTGGTCAGG No data
1182932918_1182932925 0 Left 1182932918 22:34192059-34192081 CCCAGGAAACTTGTACAGTCACA No data
Right 1182932925 22:34192082-34192104 GAAGTGTGGGCTGGGTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182932925 Original CRISPR GAAGTGTGGGCTGGGTGGTC AGG Intergenic
No off target data available for this crispr