ID: 1182932927

View in Genome Browser
Species Human (GRCh38)
Location 22:34192111-34192133
Sequence CTCTCTGAGTAAGTAACATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182932918_1182932927 29 Left 1182932918 22:34192059-34192081 CCCAGGAAACTTGTACAGTCACA No data
Right 1182932927 22:34192111-34192133 CTCTCTGAGTAAGTAACATTTGG No data
1182932919_1182932927 28 Left 1182932919 22:34192060-34192082 CCAGGAAACTTGTACAGTCACAG No data
Right 1182932927 22:34192111-34192133 CTCTCTGAGTAAGTAACATTTGG No data
1182932917_1182932927 30 Left 1182932917 22:34192058-34192080 CCCCAGGAAACTTGTACAGTCAC No data
Right 1182932927 22:34192111-34192133 CTCTCTGAGTAAGTAACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182932927 Original CRISPR CTCTCTGAGTAAGTAACATT TGG Intergenic
No off target data available for this crispr