ID: 1182951647

View in Genome Browser
Species Human (GRCh38)
Location 22:34381749-34381771
Sequence TGCTGGTGCCTCGGGAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182951643_1182951647 -10 Left 1182951643 22:34381736-34381758 CCTTCCTGGTTGATGCTGGTGCC No data
Right 1182951647 22:34381749-34381771 TGCTGGTGCCTCGGGAGCTCAGG No data
1182951640_1182951647 21 Left 1182951640 22:34381705-34381727 CCAGGATGCAGATCTCAAGGAAA No data
Right 1182951647 22:34381749-34381771 TGCTGGTGCCTCGGGAGCTCAGG No data
1182951638_1182951647 30 Left 1182951638 22:34381696-34381718 CCTAAGGAACCAGGATGCAGATC No data
Right 1182951647 22:34381749-34381771 TGCTGGTGCCTCGGGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182951647 Original CRISPR TGCTGGTGCCTCGGGAGCTC AGG Intergenic
No off target data available for this crispr