ID: 1182959936

View in Genome Browser
Species Human (GRCh38)
Location 22:34462724-34462746
Sequence ATGTCCAACTAGCAGGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182959936_1182959943 6 Left 1182959936 22:34462724-34462746 CCTTCACCCTGCTAGTTGGACAT No data
Right 1182959943 22:34462753-34462775 ATTGGGCTGCCCCCATACTTTGG No data
1182959936_1182959948 18 Left 1182959936 22:34462724-34462746 CCTTCACCCTGCTAGTTGGACAT No data
Right 1182959948 22:34462765-34462787 CCATACTTTGGTATCTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182959936 Original CRISPR ATGTCCAACTAGCAGGGTGA AGG (reversed) Intergenic
No off target data available for this crispr