ID: 1182959948

View in Genome Browser
Species Human (GRCh38)
Location 22:34462765-34462787
Sequence CCATACTTTGGTATCTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182959942_1182959948 -6 Left 1182959942 22:34462748-34462770 CCTGCATTGGGCTGCCCCCATAC No data
Right 1182959948 22:34462765-34462787 CCATACTTTGGTATCTTTTGAGG No data
1182959936_1182959948 18 Left 1182959936 22:34462724-34462746 CCTTCACCCTGCTAGTTGGACAT No data
Right 1182959948 22:34462765-34462787 CCATACTTTGGTATCTTTTGAGG No data
1182959937_1182959948 12 Left 1182959937 22:34462730-34462752 CCCTGCTAGTTGGACATCCCTGC No data
Right 1182959948 22:34462765-34462787 CCATACTTTGGTATCTTTTGAGG No data
1182959935_1182959948 19 Left 1182959935 22:34462723-34462745 CCCTTCACCCTGCTAGTTGGACA No data
Right 1182959948 22:34462765-34462787 CCATACTTTGGTATCTTTTGAGG No data
1182959941_1182959948 -5 Left 1182959941 22:34462747-34462769 CCCTGCATTGGGCTGCCCCCATA No data
Right 1182959948 22:34462765-34462787 CCATACTTTGGTATCTTTTGAGG No data
1182959938_1182959948 11 Left 1182959938 22:34462731-34462753 CCTGCTAGTTGGACATCCCTGCA No data
Right 1182959948 22:34462765-34462787 CCATACTTTGGTATCTTTTGAGG No data
1182959934_1182959948 20 Left 1182959934 22:34462722-34462744 CCCCTTCACCCTGCTAGTTGGAC No data
Right 1182959948 22:34462765-34462787 CCATACTTTGGTATCTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182959948 Original CRISPR CCATACTTTGGTATCTTTTG AGG Intergenic
No off target data available for this crispr