ID: 1182966465

View in Genome Browser
Species Human (GRCh38)
Location 22:34526208-34526230
Sequence CTGTAGAGATGGAAAGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182966465_1182966468 21 Left 1182966465 22:34526208-34526230 CCATATGCTTTCCATCTCTACAG No data
Right 1182966468 22:34526252-34526274 TCCCATCCAGAAAAATCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182966465 Original CRISPR CTGTAGAGATGGAAAGCATA TGG (reversed) Intergenic
No off target data available for this crispr