ID: 1182966934

View in Genome Browser
Species Human (GRCh38)
Location 22:34530890-34530912
Sequence GTTAATATTGGAGGACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182966934_1182966939 13 Left 1182966934 22:34530890-34530912 CCTGCCTGTCCTCCAATATTAAC No data
Right 1182966939 22:34530926-34530948 AACACCAACATCCCATTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182966934 Original CRISPR GTTAATATTGGAGGACAGGC AGG (reversed) Intergenic
No off target data available for this crispr