ID: 1182970471

View in Genome Browser
Species Human (GRCh38)
Location 22:34569744-34569766
Sequence TTCCCCCATTTCCAAAGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182970469_1182970471 25 Left 1182970469 22:34569696-34569718 CCTGGTAAAGGAAGTGCTTCTCA No data
Right 1182970471 22:34569744-34569766 TTCCCCCATTTCCAAAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182970471 Original CRISPR TTCCCCCATTTCCAAAGTAC AGG Intergenic
No off target data available for this crispr