ID: 1182971962

View in Genome Browser
Species Human (GRCh38)
Location 22:34587573-34587595
Sequence CACACTCCTTTCTCACCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182971962_1182971965 -8 Left 1182971962 22:34587573-34587595 CCAGCTGGTGAGAAAGGAGTGTG No data
Right 1182971965 22:34587588-34587610 GGAGTGTGACTTGGGAGCTCTGG No data
1182971962_1182971967 1 Left 1182971962 22:34587573-34587595 CCAGCTGGTGAGAAAGGAGTGTG No data
Right 1182971967 22:34587597-34587619 CTTGGGAGCTCTGGGACCTGTGG No data
1182971962_1182971969 19 Left 1182971962 22:34587573-34587595 CCAGCTGGTGAGAAAGGAGTGTG No data
Right 1182971969 22:34587615-34587637 TGTGGCTGCTGTCCAAAGTGAGG No data
1182971962_1182971966 -7 Left 1182971962 22:34587573-34587595 CCAGCTGGTGAGAAAGGAGTGTG No data
Right 1182971966 22:34587589-34587611 GAGTGTGACTTGGGAGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182971962 Original CRISPR CACACTCCTTTCTCACCAGC TGG (reversed) Intergenic
No off target data available for this crispr