ID: 1182973979

View in Genome Browser
Species Human (GRCh38)
Location 22:34605200-34605222
Sequence CACAGCCACATGGCTACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182973979_1182973982 16 Left 1182973979 22:34605200-34605222 CCAACTGTAGCCATGTGGCTGTG No data
Right 1182973982 22:34605239-34605261 TGTTTGAGAAACAATCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182973979 Original CRISPR CACAGCCACATGGCTACAGT TGG (reversed) Intergenic
No off target data available for this crispr