ID: 1182975482

View in Genome Browser
Species Human (GRCh38)
Location 22:34620231-34620253
Sequence TGAACAAATCGCTCTTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182975482_1182975485 27 Left 1182975482 22:34620231-34620253 CCTCTGGAAGAGCGATTTGTTCA No data
Right 1182975485 22:34620281-34620303 ATTGGCGAGTTTGCTCTTAGTGG No data
1182975482_1182975486 28 Left 1182975482 22:34620231-34620253 CCTCTGGAAGAGCGATTTGTTCA No data
Right 1182975486 22:34620282-34620304 TTGGCGAGTTTGCTCTTAGTGGG No data
1182975482_1182975483 9 Left 1182975482 22:34620231-34620253 CCTCTGGAAGAGCGATTTGTTCA No data
Right 1182975483 22:34620263-34620285 TGCTCTCAGAACTGAGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182975482 Original CRISPR TGAACAAATCGCTCTTCCAG AGG (reversed) Intergenic
No off target data available for this crispr