ID: 1182975486

View in Genome Browser
Species Human (GRCh38)
Location 22:34620282-34620304
Sequence TTGGCGAGTTTGCTCTTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182975482_1182975486 28 Left 1182975482 22:34620231-34620253 CCTCTGGAAGAGCGATTTGTTCA No data
Right 1182975486 22:34620282-34620304 TTGGCGAGTTTGCTCTTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182975486 Original CRISPR TTGGCGAGTTTGCTCTTAGT GGG Intergenic
No off target data available for this crispr