ID: 1182977637

View in Genome Browser
Species Human (GRCh38)
Location 22:34638226-34638248
Sequence CTGTAGGTGGGGAGTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182977637_1182977645 -5 Left 1182977637 22:34638226-34638248 CCCTCTGCACTCCCCACCTACAG No data
Right 1182977645 22:34638244-34638266 TACAGATGAGCACCCAGGCAGGG No data
1182977637_1182977649 10 Left 1182977637 22:34638226-34638248 CCCTCTGCACTCCCCACCTACAG No data
Right 1182977649 22:34638259-34638281 AGGCAGGGGACACTCAAAGCAGG No data
1182977637_1182977644 -6 Left 1182977637 22:34638226-34638248 CCCTCTGCACTCCCCACCTACAG No data
Right 1182977644 22:34638243-34638265 CTACAGATGAGCACCCAGGCAGG No data
1182977637_1182977650 19 Left 1182977637 22:34638226-34638248 CCCTCTGCACTCCCCACCTACAG No data
Right 1182977650 22:34638268-34638290 ACACTCAAAGCAGGTGAATGAGG No data
1182977637_1182977651 28 Left 1182977637 22:34638226-34638248 CCCTCTGCACTCCCCACCTACAG No data
Right 1182977651 22:34638277-34638299 GCAGGTGAATGAGGTAATAGTGG No data
1182977637_1182977646 -4 Left 1182977637 22:34638226-34638248 CCCTCTGCACTCCCCACCTACAG No data
Right 1182977646 22:34638245-34638267 ACAGATGAGCACCCAGGCAGGGG No data
1182977637_1182977642 -10 Left 1182977637 22:34638226-34638248 CCCTCTGCACTCCCCACCTACAG No data
Right 1182977642 22:34638239-34638261 CCACCTACAGATGAGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182977637 Original CRISPR CTGTAGGTGGGGAGTGCAGA GGG (reversed) Intergenic
No off target data available for this crispr