ID: 1182977865

View in Genome Browser
Species Human (GRCh38)
Location 22:34640371-34640393
Sequence CAGGCTGAGGACTCGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182977857_1182977865 -7 Left 1182977857 22:34640355-34640377 CCAGAAGCCCATCAATCAGGCTG No data
Right 1182977865 22:34640371-34640393 CAGGCTGAGGACTCGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182977865 Original CRISPR CAGGCTGAGGACTCGGGGGC AGG Intergenic
No off target data available for this crispr