ID: 1182977919

View in Genome Browser
Species Human (GRCh38)
Location 22:34640700-34640722
Sequence AGAATACTGATGAACCCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182977919_1182977921 3 Left 1182977919 22:34640700-34640722 CCATTGGGGTTCATCAGTATTCT No data
Right 1182977921 22:34640726-34640748 CTGCCTGGCTTAGATACCACTGG No data
1182977919_1182977924 26 Left 1182977919 22:34640700-34640722 CCATTGGGGTTCATCAGTATTCT No data
Right 1182977924 22:34640749-34640771 CTCAGTATTGCAGAGCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182977919 Original CRISPR AGAATACTGATGAACCCCAA TGG (reversed) Intergenic
No off target data available for this crispr