ID: 1182979213

View in Genome Browser
Species Human (GRCh38)
Location 22:34652580-34652602
Sequence TTGGTTGTCCCCTACTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182979213_1182979221 24 Left 1182979213 22:34652580-34652602 CCTTGAAAGTAGGGGACAACCAA No data
Right 1182979221 22:34652627-34652649 AGATCCCGAAGTGGAAAAAGGGG No data
1182979213_1182979215 0 Left 1182979213 22:34652580-34652602 CCTTGAAAGTAGGGGACAACCAA No data
Right 1182979215 22:34652603-34652625 ACTGCCAATCTGACGAGAAGAGG No data
1182979213_1182979219 22 Left 1182979213 22:34652580-34652602 CCTTGAAAGTAGGGGACAACCAA No data
Right 1182979219 22:34652625-34652647 GGAGATCCCGAAGTGGAAAAAGG No data
1182979213_1182979220 23 Left 1182979213 22:34652580-34652602 CCTTGAAAGTAGGGGACAACCAA No data
Right 1182979220 22:34652626-34652648 GAGATCCCGAAGTGGAAAAAGGG No data
1182979213_1182979218 15 Left 1182979213 22:34652580-34652602 CCTTGAAAGTAGGGGACAACCAA No data
Right 1182979218 22:34652618-34652640 AGAAGAGGGAGATCCCGAAGTGG No data
1182979213_1182979216 1 Left 1182979213 22:34652580-34652602 CCTTGAAAGTAGGGGACAACCAA No data
Right 1182979216 22:34652604-34652626 CTGCCAATCTGACGAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182979213 Original CRISPR TTGGTTGTCCCCTACTTTCA AGG (reversed) Intergenic
No off target data available for this crispr