ID: 1182981358

View in Genome Browser
Species Human (GRCh38)
Location 22:34674435-34674457
Sequence CTGCTGTTCTTCTAAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182981358_1182981363 25 Left 1182981358 22:34674435-34674457 CCATTTTTTTAGAAGAACAGCAG No data
Right 1182981363 22:34674483-34674505 TTGTTCGCCATTCATCCTGGAGG No data
1182981358_1182981362 22 Left 1182981358 22:34674435-34674457 CCATTTTTTTAGAAGAACAGCAG No data
Right 1182981362 22:34674480-34674502 AAATTGTTCGCCATTCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182981358 Original CRISPR CTGCTGTTCTTCTAAAAAAA TGG (reversed) Intergenic
No off target data available for this crispr