ID: 1182989182

View in Genome Browser
Species Human (GRCh38)
Location 22:34750714-34750736
Sequence CAGCAGGGTTGGAGGAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182989176_1182989182 6 Left 1182989176 22:34750685-34750707 CCAGATGGTAAGCTAGACTTGGA No data
Right 1182989182 22:34750714-34750736 CAGCAGGGTTGGAGGAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182989182 Original CRISPR CAGCAGGGTTGGAGGAAAGT GGG Intergenic
No off target data available for this crispr