ID: 1182991039

View in Genome Browser
Species Human (GRCh38)
Location 22:34768031-34768053
Sequence TATTATTTTCAGAAAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182991036_1182991039 3 Left 1182991036 22:34768005-34768027 CCAGGAGAGCATCCATGGGACAT No data
Right 1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG No data
1182991035_1182991039 4 Left 1182991035 22:34768004-34768026 CCCAGGAGAGCATCCATGGGACA No data
Right 1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG No data
1182991037_1182991039 -9 Left 1182991037 22:34768017-34768039 CCATGGGACATGACTATTATTTT No data
Right 1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182991039 Original CRISPR TATTATTTTCAGAAAATGGA AGG Intergenic
No off target data available for this crispr