ID: 1182991893

View in Genome Browser
Species Human (GRCh38)
Location 22:34776214-34776236
Sequence TCCCACTCAGCCTGGTTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182991893_1182991898 -1 Left 1182991893 22:34776214-34776236 CCCACTAACCAGGCTGAGTGGGA No data
Right 1182991898 22:34776236-34776258 ATTCCAAGAGGACTTCCTGGAGG No data
1182991893_1182991901 3 Left 1182991893 22:34776214-34776236 CCCACTAACCAGGCTGAGTGGGA No data
Right 1182991901 22:34776240-34776262 CAAGAGGACTTCCTGGAGGAGGG No data
1182991893_1182991900 2 Left 1182991893 22:34776214-34776236 CCCACTAACCAGGCTGAGTGGGA No data
Right 1182991900 22:34776239-34776261 CCAAGAGGACTTCCTGGAGGAGG No data
1182991893_1182991897 -4 Left 1182991893 22:34776214-34776236 CCCACTAACCAGGCTGAGTGGGA No data
Right 1182991897 22:34776233-34776255 GGGATTCCAAGAGGACTTCCTGG No data
1182991893_1182991905 24 Left 1182991893 22:34776214-34776236 CCCACTAACCAGGCTGAGTGGGA No data
Right 1182991905 22:34776261-34776283 GGACACATTGGCTGAGTATTGGG No data
1182991893_1182991902 12 Left 1182991893 22:34776214-34776236 CCCACTAACCAGGCTGAGTGGGA No data
Right 1182991902 22:34776249-34776271 TTCCTGGAGGAGGGACACATTGG No data
1182991893_1182991904 23 Left 1182991893 22:34776214-34776236 CCCACTAACCAGGCTGAGTGGGA No data
Right 1182991904 22:34776260-34776282 GGGACACATTGGCTGAGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182991893 Original CRISPR TCCCACTCAGCCTGGTTAGT GGG (reversed) Intergenic