ID: 1182991897

View in Genome Browser
Species Human (GRCh38)
Location 22:34776233-34776255
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182991893_1182991897 -4 Left 1182991893 22:34776214-34776236 CCCACTAACCAGGCTGAGTGGGA No data
Right 1182991897 22:34776233-34776255 GGGATTCCAAGAGGACTTCCTGG No data
1182991894_1182991897 -5 Left 1182991894 22:34776215-34776237 CCACTAACCAGGCTGAGTGGGAT No data
Right 1182991897 22:34776233-34776255 GGGATTCCAAGAGGACTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182991897 Original CRISPR GGGATTCCAAGAGGACTTCC TGG Intergenic
No off target data available for this crispr