ID: 1182995427

View in Genome Browser
Species Human (GRCh38)
Location 22:34807859-34807881
Sequence GAGCCTATTGTGCTTCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182995427_1182995431 25 Left 1182995427 22:34807859-34807881 CCTCTGAGAAGCACAATAGGCTC No data
Right 1182995431 22:34807907-34807929 ATTCTTCTCCCTCACAAAGCTGG No data
1182995427_1182995429 -2 Left 1182995427 22:34807859-34807881 CCTCTGAGAAGCACAATAGGCTC No data
Right 1182995429 22:34807880-34807902 TCTGCCTGGTGTGAACTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182995427 Original CRISPR GAGCCTATTGTGCTTCTCAG AGG (reversed) Intergenic
No off target data available for this crispr