ID: 1182995593

View in Genome Browser
Species Human (GRCh38)
Location 22:34809128-34809150
Sequence TTCTTGAAACTCTACCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182995593_1182995597 2 Left 1182995593 22:34809128-34809150 CCAAGAAGGTAGAGTTTCAAGAA No data
Right 1182995597 22:34809153-34809175 AGGAGGTGGCAAGAATGACAAGG No data
1182995593_1182995600 25 Left 1182995593 22:34809128-34809150 CCAAGAAGGTAGAGTTTCAAGAA No data
Right 1182995600 22:34809176-34809198 AGGTTGAAGGAGATAAGAACTGG No data
1182995593_1182995599 12 Left 1182995593 22:34809128-34809150 CCAAGAAGGTAGAGTTTCAAGAA No data
Right 1182995599 22:34809163-34809185 AAGAATGACAAGGAGGTTGAAGG No data
1182995593_1182995598 5 Left 1182995593 22:34809128-34809150 CCAAGAAGGTAGAGTTTCAAGAA No data
Right 1182995598 22:34809156-34809178 AGGTGGCAAGAATGACAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182995593 Original CRISPR TTCTTGAAACTCTACCTTCT TGG (reversed) Intergenic
No off target data available for this crispr