ID: 1182995599

View in Genome Browser
Species Human (GRCh38)
Location 22:34809163-34809185
Sequence AAGAATGACAAGGAGGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182995593_1182995599 12 Left 1182995593 22:34809128-34809150 CCAAGAAGGTAGAGTTTCAAGAA No data
Right 1182995599 22:34809163-34809185 AAGAATGACAAGGAGGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182995599 Original CRISPR AAGAATGACAAGGAGGTTGA AGG Intergenic
No off target data available for this crispr