ID: 1183000232

View in Genome Browser
Species Human (GRCh38)
Location 22:34850841-34850863
Sequence AGTCCACCTGGAGCACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183000218_1183000232 27 Left 1183000218 22:34850791-34850813 CCCCTTTCCTGTAACATGTGTGT No data
Right 1183000232 22:34850841-34850863 AGTCCACCTGGAGCACAGGCTGG No data
1183000220_1183000232 25 Left 1183000220 22:34850793-34850815 CCTTTCCTGTAACATGTGTGTCT No data
Right 1183000232 22:34850841-34850863 AGTCCACCTGGAGCACAGGCTGG No data
1183000219_1183000232 26 Left 1183000219 22:34850792-34850814 CCCTTTCCTGTAACATGTGTGTC No data
Right 1183000232 22:34850841-34850863 AGTCCACCTGGAGCACAGGCTGG No data
1183000226_1183000232 -9 Left 1183000226 22:34850827-34850849 CCACCTTGAGCCCTAGTCCACCT No data
Right 1183000232 22:34850841-34850863 AGTCCACCTGGAGCACAGGCTGG No data
1183000221_1183000232 20 Left 1183000221 22:34850798-34850820 CCTGTAACATGTGTGTCTATTTC No data
Right 1183000232 22:34850841-34850863 AGTCCACCTGGAGCACAGGCTGG No data
1183000225_1183000232 -2 Left 1183000225 22:34850820-34850842 CCAGGGGCCACCTTGAGCCCTAG No data
Right 1183000232 22:34850841-34850863 AGTCCACCTGGAGCACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183000232 Original CRISPR AGTCCACCTGGAGCACAGGC TGG Intergenic
No off target data available for this crispr