ID: 1183000398

View in Genome Browser
Species Human (GRCh38)
Location 22:34852637-34852659
Sequence TTTCACATGAGACATGTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183000396_1183000398 19 Left 1183000396 22:34852595-34852617 CCTTTACTCTCTTTTTAATTTTT No data
Right 1183000398 22:34852637-34852659 TTTCACATGAGACATGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183000398 Original CRISPR TTTCACATGAGACATGTAAT TGG Intergenic
No off target data available for this crispr