ID: 1183000781

View in Genome Browser
Species Human (GRCh38)
Location 22:34856932-34856954
Sequence AGCAAGGCTGGGCCTACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183000774_1183000781 6 Left 1183000774 22:34856903-34856925 CCTAGAGGTCCCTCCAGCTTCAC No data
Right 1183000781 22:34856932-34856954 AGCAAGGCTGGGCCTACAGATGG No data
1183000771_1183000781 22 Left 1183000771 22:34856887-34856909 CCCTTTGGTGGCAGATCCTAGAG No data
Right 1183000781 22:34856932-34856954 AGCAAGGCTGGGCCTACAGATGG No data
1183000775_1183000781 -3 Left 1183000775 22:34856912-34856934 CCCTCCAGCTTCACAGCTTGAGC No data
Right 1183000781 22:34856932-34856954 AGCAAGGCTGGGCCTACAGATGG No data
1183000777_1183000781 -7 Left 1183000777 22:34856916-34856938 CCAGCTTCACAGCTTGAGCAAGG No data
Right 1183000781 22:34856932-34856954 AGCAAGGCTGGGCCTACAGATGG No data
1183000776_1183000781 -4 Left 1183000776 22:34856913-34856935 CCTCCAGCTTCACAGCTTGAGCA No data
Right 1183000781 22:34856932-34856954 AGCAAGGCTGGGCCTACAGATGG No data
1183000772_1183000781 21 Left 1183000772 22:34856888-34856910 CCTTTGGTGGCAGATCCTAGAGG No data
Right 1183000781 22:34856932-34856954 AGCAAGGCTGGGCCTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183000781 Original CRISPR AGCAAGGCTGGGCCTACAGA TGG Intergenic
No off target data available for this crispr