ID: 1183009457

View in Genome Browser
Species Human (GRCh38)
Location 22:34932868-34932890
Sequence GGCCTGCAGAGCCAAAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183009453_1183009457 3 Left 1183009453 22:34932842-34932864 CCTCACCTATAAAGTGAGTAGAG No data
Right 1183009457 22:34932868-34932890 GGCCTGCAGAGCCAAAGTGAGGG No data
1183009451_1183009457 27 Left 1183009451 22:34932818-34932840 CCTTCTCTCCATGAGCTTCAAAT No data
Right 1183009457 22:34932868-34932890 GGCCTGCAGAGCCAAAGTGAGGG No data
1183009452_1183009457 19 Left 1183009452 22:34932826-34932848 CCATGAGCTTCAAATTCCTCACC No data
Right 1183009457 22:34932868-34932890 GGCCTGCAGAGCCAAAGTGAGGG No data
1183009454_1183009457 -2 Left 1183009454 22:34932847-34932869 CCTATAAAGTGAGTAGAGAATGG No data
Right 1183009457 22:34932868-34932890 GGCCTGCAGAGCCAAAGTGAGGG No data
1183009450_1183009457 28 Left 1183009450 22:34932817-34932839 CCCTTCTCTCCATGAGCTTCAAA No data
Right 1183009457 22:34932868-34932890 GGCCTGCAGAGCCAAAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183009457 Original CRISPR GGCCTGCAGAGCCAAAGTGA GGG Intergenic
No off target data available for this crispr