ID: 1183015617

View in Genome Browser
Species Human (GRCh38)
Location 22:34984066-34984088
Sequence GGGTGTCAGTGGGAAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183015617_1183015627 27 Left 1183015617 22:34984066-34984088 CCCTCCCCTTCCCACTGACACCC No data
Right 1183015627 22:34984116-34984138 CTCTCAGCTGCCACTATGGTTGG No data
1183015617_1183015626 23 Left 1183015617 22:34984066-34984088 CCCTCCCCTTCCCACTGACACCC No data
Right 1183015626 22:34984112-34984134 TCTGCTCTCAGCTGCCACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183015617 Original CRISPR GGGTGTCAGTGGGAAGGGGA GGG (reversed) Intergenic
No off target data available for this crispr