ID: 1183020570

View in Genome Browser
Species Human (GRCh38)
Location 22:35023021-35023043
Sequence TCTAGGGCCCCGCCGTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183020570_1183020576 22 Left 1183020570 22:35023021-35023043 CCAGGAAACGGCGGGGCCCTAGA No data
Right 1183020576 22:35023066-35023088 AGACCCCCAGTTGCCGACCGAGG No data
1183020570_1183020579 26 Left 1183020570 22:35023021-35023043 CCAGGAAACGGCGGGGCCCTAGA No data
Right 1183020579 22:35023070-35023092 CCCCAGTTGCCGACCGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183020570 Original CRISPR TCTAGGGCCCCGCCGTTTCC TGG (reversed) Intergenic
No off target data available for this crispr