ID: 1183024286

View in Genome Browser
Species Human (GRCh38)
Location 22:35052426-35052448
Sequence CTGGGGATGGGGATGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1965
Summary {0: 1, 1: 2, 2: 24, 3: 228, 4: 1710}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183024286_1183024296 7 Left 1183024286 22:35052426-35052448 CCATCCACCATCCCCATCCCCAG 0: 1
1: 2
2: 24
3: 228
4: 1710
Right 1183024296 22:35052456-35052478 TCAGGTGTCAGCTTCAAACCTGG 0: 1
1: 0
2: 0
3: 10
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183024286 Original CRISPR CTGGGGATGGGGATGGTGGA TGG (reversed) Intergenic
900005172 1:40582-40604 TTGGGGATGGGGATGGAAGTGGG - Intergenic
900105073 1:977861-977883 CCGGGGTTGGGGGTGGTGGGAGG - Intronic
900209441 1:1446656-1446678 GTGGGGATGGGGTCGGTGGGTGG + Intergenic
900219260 1:1498518-1498540 GTGGGGATGGGGTCGGTGGGTGG + Intergenic
900269759 1:1781055-1781077 GCAGGGATGGGGAGGGTGGAGGG + Intergenic
900338258 1:2175472-2175494 CTGGGGGTTGGGTTGGTGGTGGG - Intronic
900415592 1:2533045-2533067 CTGCGGAGGGGGCTGGAGGAGGG + Intergenic
900478539 1:2887402-2887424 CTGAGGATGGGGGTCGGGGAAGG + Intergenic
900513961 1:3072675-3072697 CTGGGGAGGGGACTGGTGGACGG - Intronic
900593827 1:3471525-3471547 CATGGGATGGGGCTGGGGGAGGG + Intronic
900637475 1:3672984-3673006 CTGGGTATGAGGAGGGTGGGTGG - Intronic
901146074 1:7065432-7065454 ATGGGGATGGGAATGGAGGAAGG + Intronic
901163865 1:7201050-7201072 CTGGCGGTGGGGAGTGTGGATGG - Intronic
901445801 1:9307399-9307421 CAGGGGCTGGGGAGGGAGGATGG - Intronic
901757697 1:11451272-11451294 CTGGGGCTGGGGAAGCGGGAGGG + Intergenic
901842165 1:11960623-11960645 CTGGGGTTGGGGATGGGGAAGGG - Intronic
901842823 1:11964585-11964607 CTGGTGGTGGGGAAGATGGAGGG - Intronic
902081487 1:13823884-13823906 CAGGGAATGGGGACGGTGTATGG + Exonic
902112962 1:14098596-14098618 CTGGGCAGAGGGATGCTGGAGGG - Intergenic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
902385155 1:16072222-16072244 CTGGGGAAGGGGAAGGTACAGGG - Intronic
902465824 1:16617926-16617948 TTGGGGATGGGGAGGGAGGGAGG + Intergenic
902542743 1:17166227-17166249 CTGATGGTGGGGATGGTGGTGGG - Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902785956 1:18732863-18732885 CTGGGGATGGGCAGGAGGGAAGG + Intronic
902791677 1:18773060-18773082 GCAGGGATGGGGATGGTGGGTGG + Intergenic
902982676 1:20137231-20137253 CTTGGTAGGGGGAGGGTGGAGGG + Intergenic
903015044 1:20356093-20356115 CAGGGGATGGGGAGTGTGCAGGG - Intergenic
903261974 1:22136398-22136420 CTGGGGTTGGGGAAAGAGGAGGG + Intronic
903333399 1:22609015-22609037 CCCGTGTTGGGGATGGTGGAAGG + Intergenic
903420372 1:23214734-23214756 CAGGGCATGGGGCAGGTGGAGGG - Intergenic
903557859 1:24206398-24206420 CTGGGGCTGGGGAAGGGAGAGGG - Intergenic
903673195 1:25048369-25048391 CTGGTGATGGCGATGGTGATGGG - Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904254324 1:29244954-29244976 GTGGGGACGGGGGTGGTGGTTGG + Intronic
904497094 1:30893144-30893166 CTGAGGGTGGGGAAGGTGCAGGG + Intronic
904825197 1:33269735-33269757 CTGGGGCGGGGGTTGGGGGATGG + Intronic
904841298 1:33373557-33373579 CTGGGGATGGGGAGGATCAAAGG - Intronic
904921152 1:34009348-34009370 CGGGGGTGGGGGAAGGTGGAAGG + Intronic
904962170 1:34342204-34342226 GTGAGGATAGGGATGGGGGAGGG + Intergenic
905011704 1:34751550-34751572 CTGGAGGTGGGAAGGGTGGAAGG - Intronic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905182563 1:36176104-36176126 CTTGGCATGGGGATGGTGCCTGG + Intronic
905238379 1:36566014-36566036 CTGGGGAATGGGATGGATGATGG - Intergenic
905240299 1:36576775-36576797 CTGGGGTCGGGGAGGGAGGAGGG + Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905322854 1:37130171-37130193 CTGGGGTGGGGGAAGGGGGATGG - Intergenic
905333847 1:37229698-37229720 CAGGGGCTGGGGTTGGGGGATGG - Intergenic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
905393252 1:37651389-37651411 CTGGGGATTGGAGGGGTGGAGGG - Intergenic
905509946 1:38511278-38511300 CCGGGGATGGGGAAGGTTGCAGG + Intergenic
905792470 1:40797613-40797635 CTGGCGAGGAGGATGCTGGAGGG + Intronic
905863543 1:41365183-41365205 CTGGGGATGGGGGTAGGGAAAGG + Intronic
905906121 1:41619606-41619628 ATGAGGATGGTGATGGTGGCTGG + Intronic
905921652 1:41723330-41723352 ATAAGGATGGGGATGGTGGCAGG - Intronic
905964442 1:42080538-42080560 CTGGGGATGGGGATGCCAGGTGG + Intergenic
905970558 1:42138693-42138715 CTGGGTATGGGGAGAGTGGGAGG - Intergenic
906197856 1:43940150-43940172 CTGGGGATAGGGAAAGGGGATGG - Intergenic
906580279 1:46930203-46930225 ATGGGGATGGGGATCCTGGTGGG + Exonic
906593655 1:47053059-47053081 GTGGGGTGGGGGATGGGGGAGGG - Intergenic
906603447 1:47148687-47148709 ATGGGGATGGGGATCCTGGTGGG - Exonic
906710359 1:47924829-47924851 CTGGGGATGGGAAAGGTGCAGGG + Intronic
906715501 1:47965560-47965582 TTGGGGTTGGGGCTGGGGGAGGG - Intronic
906748101 1:48235611-48235633 CTGGGGGTGGGGATGAGAGAGGG - Intronic
906792150 1:48668483-48668505 CTGGGGCTGGGGCCTGTGGAAGG - Intronic
906799123 1:48720831-48720853 CTGGGGCTGGGAATGAAGGATGG + Intronic
906911679 1:49958693-49958715 GTGGGGTTGGGGAGGGGGGAGGG + Intronic
907221958 1:52913699-52913721 TGGGGGATGGGGATTGCGGAAGG - Intronic
907326895 1:53644153-53644175 CTGGTGATTGGGATGGTGGTAGG - Intronic
907379777 1:54076927-54076949 AGGGGGATGGGGAACGTGGATGG + Intronic
907526403 1:55056514-55056536 CTGGGGATGGAGATGGGGAGGGG - Intronic
907530933 1:55096029-55096051 CTGGGAGTGGGGATTGTAGAGGG + Intronic
908266795 1:62387203-62387225 CTAGTGAGGGGGCTGGTGGATGG - Intergenic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
909036968 1:70604404-70604426 CAGGGCACAGGGATGGTGGAGGG - Intergenic
909048929 1:70745413-70745435 CTGGGGTTGGGGGAGGTGGAGGG + Intergenic
909316725 1:74229689-74229711 GTGGGGTTGGGGATGGTTAAGGG + Intronic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
910338785 1:86162492-86162514 GTGGGGTGGGGGATGGGGGAAGG - Intergenic
910457539 1:87413535-87413557 CTGCGGCTGGGCATGGTGGAAGG - Intergenic
910545587 1:88413072-88413094 CAGGGGATGGGGAGGATGGTGGG + Intergenic
910639233 1:89441972-89441994 AGGGAGATTGGGATGGTGGAGGG - Intergenic
910643483 1:89489388-89489410 CTGGGGCTTGGAATGGGGGAAGG - Intergenic
910840680 1:91558426-91558448 TTGGGGAGGGGGAAGGGGGATGG - Intergenic
910864709 1:91777564-91777586 TTGGGGCTGGGGCTGGGGGAAGG - Intronic
911055191 1:93702548-93702570 GTGGGGGTGGGGATGGGGGTTGG + Intronic
911073994 1:93855336-93855358 GTGGGTTTGGGGATGGGGGATGG + Intergenic
911242767 1:95483469-95483491 CTGGAGCTGGGGATGCTGGATGG + Intergenic
911451404 1:98066501-98066523 TTGGGTAGGGGGATAGTGGAGGG + Intergenic
911506309 1:98756903-98756925 TTGGAGTTGGGGCTGGTGGAAGG + Intronic
911630525 1:100178832-100178854 CTGGAGGCAGGGATGGTGGAAGG - Intergenic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
911887160 1:103317763-103317785 ATGGGGATGGTGAGGGTGGAAGG + Intergenic
911995212 1:104758069-104758091 AGGGGGATGGGGAGGGGGGATGG + Intergenic
912465037 1:109866541-109866563 ATGGGGATGGGGGTGGGGGTGGG + Intergenic
912510706 1:110188453-110188475 CTGGGGATGAGTATGCCGGAAGG - Intronic
912563270 1:110565568-110565590 CTGGGGAAGGGGATGTGGGGTGG + Intergenic
912954475 1:114144925-114144947 CTTGGGAAGGGGGTGGTGGTAGG - Intronic
913063908 1:115232243-115232265 ATGGGGATGGGGATGGGGATGGG + Intergenic
913063913 1:115232255-115232277 ATGGGGATGGGGAGGGCAGAGGG + Intergenic
913161916 1:116152481-116152503 CTGGGGATCGGGGTGGGGGGTGG + Intergenic
913326819 1:117634974-117634996 GTGGTGAGGGGCATGGTGGAAGG - Intergenic
913466357 1:119147233-119147255 CTGGGGAAGGGGCTGGCGGAGGG - Intergenic
913975540 1:143451740-143451762 CTGGGGGTGGGGGGGGTGGGGGG - Intergenic
914445935 1:147750840-147750862 ATGGGGTGGGGGATGGTGGTAGG - Intergenic
914514504 1:148362616-148362638 CTGGGGGTGGGGGTGGGGGGCGG - Intergenic
915147957 1:153806490-153806512 CTGGGGAAGGGGAGGGGGTAGGG - Exonic
915168470 1:153962029-153962051 CAGGGAATGGGGAAGGGGGAGGG + Intronic
915310488 1:155003836-155003858 CTTGGGATGGGGTGGGAGGAGGG - Intronic
915326191 1:155082307-155082329 CCGGGGCTGGGGGTGGAGGATGG + Intronic
915441995 1:155951165-155951187 CTCGGGATGGGGAGGCTGGCAGG - Exonic
915891216 1:159775639-159775661 CTGGAGATGGGGAGGGAGGTGGG - Intergenic
915930926 1:160060638-160060660 CTGGGGCCTGGGAGGGTGGATGG - Intronic
915943431 1:160133480-160133502 GTTGGGATGGGGAGGGTGGCTGG - Intronic
916397044 1:164402274-164402296 CTGGTGGTGGGGATGGGGGGTGG + Intergenic
916850133 1:168695182-168695204 CTTGGGATGAGGAAGGTTGAAGG + Intergenic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917638383 1:176958833-176958855 CATGGGATGGGGACGGTGGGAGG - Intronic
918144069 1:181740514-181740536 GTGGGGGTGGGGATAGTGGAGGG + Intronic
918263747 1:182820799-182820821 CTGGAGGTGGGGCTGGTGGGAGG - Intronic
918282816 1:183023142-183023164 CGGGGGAGGGGGTTGGGGGAGGG - Intergenic
918466605 1:184827305-184827327 CGGAGGATGAGGATGGTGGTTGG - Intronic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
918950033 1:191125451-191125473 CTGAGGATGGGGTTGGGAGAAGG - Intergenic
919522515 1:198606104-198606126 CTGGGGTTGGGAATGGGGGTGGG + Intergenic
919553035 1:199015985-199016007 CAGGAGATGGGGATGATGGGGGG - Intergenic
919922334 1:202174080-202174102 CTGGGGCTGGGGAGGATGGGTGG + Intergenic
919963398 1:202495510-202495532 CTGGGGATGTGCACTGTGGAGGG - Intronic
919972793 1:202591708-202591730 CTGTGGGTGGTGATGGAGGAGGG - Exonic
920200656 1:204257915-204257937 GTGGGGCTGGGGTGGGTGGAGGG - Intronic
920230577 1:204467132-204467154 CAGGGGATGGGGAAGGGTGAGGG + Intronic
920350866 1:205337071-205337093 CTGGAGATGGGGGTGGGGGGAGG + Exonic
920438907 1:205965509-205965531 CTGGGGGTGGGAATGGGGGTAGG + Intergenic
920894360 1:210030288-210030310 ATGGGCATGGGCATGGTGGCAGG - Intronic
920917943 1:210273014-210273036 CTGGGGGCGGGGATGGGGGCTGG + Intergenic
921264880 1:213414103-213414125 CTGGAGGTGGGGATGGGGGAAGG + Intergenic
921358202 1:214306222-214306244 CCGGGGATGGGGCTGGAGGGTGG - Intronic
921386234 1:214572619-214572641 ATGGGGATAGGGCAGGTGGAGGG - Intergenic
921468745 1:215523044-215523066 CTGGAGATGGGGTTGGGGGCAGG - Intergenic
921490464 1:215769661-215769683 ATGGGGGTAGGGCTGGTGGAAGG + Intronic
921841310 1:219831609-219831631 CTGGGGTTGGGGGTAGGGGAGGG - Intronic
922000349 1:221471263-221471285 ATGGGGAGGGTGATGGTGGAAGG - Intergenic
922229314 1:223671951-223671973 CTGGGGATGAGTGTGGAGGAAGG + Intergenic
922272071 1:224043603-224043625 ATGGGGAGGAGGATGTTGGAGGG - Intergenic
922447846 1:225712592-225712614 TAGGGGATGGGGATGGGGTAGGG - Intergenic
922669012 1:227494897-227494919 CTGGGGGTGGGGATAGGAGAGGG - Intergenic
922670585 1:227506405-227506427 CTGGGGGTGGGGATAGGAGAGGG + Intergenic
922689440 1:227676663-227676685 GTGGGGAGGGGGAGGGGGGAGGG - Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922739941 1:228009103-228009125 GTGGTGGTGGGGATGGGGGAGGG - Intronic
922811378 1:228417074-228417096 CTGGGGTTGGGGCTGCGGGAGGG + Intergenic
923014101 1:230112654-230112676 GTGGGGATGAGGATGGCGAAGGG + Intronic
923119794 1:230979136-230979158 CAGGGGAAGGGGAACGTGGATGG + Exonic
923127268 1:231042829-231042851 ATGGTGATGGGTATGGTGGCGGG - Intergenic
923334015 1:232951250-232951272 ATGGAGATGGGGATGGGGGTGGG - Intronic
923542612 1:234899359-234899381 CTGGGCATGGGGGTGGGGGTAGG - Intergenic
923697749 1:236270850-236270872 CTGGGGTAGGGGATGGATGATGG + Intronic
923743098 1:236674179-236674201 GTGGGGATTGGGAAGTTGGAGGG - Intergenic
924242907 1:242057319-242057341 CTGGGGGTGGGGGTGGAGGTGGG + Intergenic
924379087 1:243445268-243445290 ATGGGGATGGGAATGGAGGGTGG - Intronic
924505697 1:244681487-244681509 CTGGGGCGGGGGAGGGAGGATGG + Intronic
924608016 1:245551827-245551849 CTGGGGTTGGGGAGGTTGGCAGG - Intronic
924610213 1:245567455-245567477 CTGGGGATGGGAGGGGTGAAGGG - Intronic
924664281 1:246054702-246054724 CTGGGGCTGGGGGTGGGTGAGGG + Intronic
924680212 1:246223315-246223337 CTGATGAAGGGGATGGTGGTAGG + Intronic
1062932236 10:1360971-1360993 GGGGGGCTGGGGAGGGTGGAGGG + Intronic
1063367509 10:5500026-5500048 CTGAGGCTGGGGCTGGTGGAAGG + Intergenic
1063579528 10:7293195-7293217 CTGAGGCTGGAGATGGTGGTGGG - Intronic
1063676108 10:8141685-8141707 GTGGGGGTGGGGATGGGGGTGGG - Intergenic
1063680465 10:8182359-8182381 CTGGGGGTGGGGGTGGGGGAAGG + Intergenic
1063753324 10:8977012-8977034 CTGGGGATGTGGAAGGAGGGGGG + Intergenic
1063907960 10:10799592-10799614 CTGGGGGTGGGGGTGGGGGTAGG - Intergenic
1064242805 10:13646411-13646433 GTGGGGATGGCTATGGGGGAAGG - Exonic
1064495466 10:15905508-15905530 CTGGGGATTAGGGTGGTGGCGGG - Intergenic
1064598802 10:16972755-16972777 CTGGTGATAGAGATGGTGGGGGG - Intronic
1064687984 10:17884250-17884272 CAGGGGCTGGGGATGGTGGCTGG - Intronic
1065680590 10:28227459-28227481 CGGGGGTTGGGGGTGGGGGAAGG - Intronic
1065810035 10:29433857-29433879 GTGGGAATGGGGATGGTTAATGG - Intergenic
1066393299 10:34996119-34996141 CTGGTGGTGGGGAATGTGGAGGG + Intergenic
1066431617 10:35357184-35357206 CTGGGGCTGGGGCTGGGGCAGGG - Intronic
1067112180 10:43408636-43408658 CTGGGGGTGGGGACGGGGGGTGG - Intronic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067229728 10:44397720-44397742 CTGGGGCAGGGAATGGGGGAGGG + Intergenic
1067317247 10:45180334-45180356 CTGGGGCTGGGGCTGGGGAAGGG + Intergenic
1067443447 10:46326262-46326284 CTGGTGTTAGGGATGATGGAAGG + Intronic
1067955111 10:50782599-50782621 TTGGGGTGGGGGATGGGGGAGGG - Intronic
1068052426 10:51967410-51967432 GTGGGGTGGGGGATGGGGGAGGG + Intronic
1068134132 10:52934997-52935019 CTGGGGGTGGGGTTGGGGGTGGG + Intergenic
1068390836 10:56394882-56394904 CTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1068395631 10:56457348-56457370 CTGGGGATGAGGATGCCAGATGG - Intergenic
1068405289 10:56580740-56580762 CTGGGGATGGGGATAGGGGTGGG + Intergenic
1068413728 10:56689800-56689822 GTGGGGTGGGGGATGGGGGAGGG + Intergenic
1068568863 10:58606412-58606434 CTGGGGTGGGGGAGGGGGGAGGG + Intronic
1068632087 10:59308562-59308584 CTGGTGGTGGTGATGGTGGTTGG - Intronic
1068894511 10:62185006-62185028 TTGGGGATGGTGATGATGGCAGG - Intronic
1069497182 10:68916034-68916056 CTGGGAAGGGGCATGCTGGATGG + Intronic
1069595764 10:69669048-69669070 CTGAGGCTGGGGATGGGGGTGGG + Intergenic
1069622479 10:69846372-69846394 CTGGGGTTGGGGTTGGGGGGAGG + Intronic
1069713640 10:70506890-70506912 CTGGGGGTGGGGGTGGTCAAAGG + Intronic
1069789855 10:71012549-71012571 CTGGGGATGGGGGTGGCGTGGGG + Intergenic
1069984136 10:72272614-72272636 GTGGGGATGGGGGTTGCGGAGGG + Intergenic
1070065690 10:73031627-73031649 CAGGGGATGGGGATGGGGCTGGG + Intronic
1070118932 10:73556886-73556908 CTGGGAATGGTGCTGGTAGAGGG - Intronic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1070838495 10:79467043-79467065 CAGGGGCTGGGGAGGGTGGAGGG + Intergenic
1070891012 10:79942242-79942264 GTGGGGATTGGGAGGGTGCATGG + Intronic
1071064447 10:81614269-81614291 CTGGGCATGGGGATGGGGGTCGG + Intergenic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1071396933 10:85233296-85233318 CTGTGGATGGGGGTGGTGAGCGG + Intergenic
1071445138 10:85738831-85738853 CTGGAGGTGGGGATGGGAGAAGG + Intronic
1071546127 10:86531098-86531120 CTGGGGAAGGGGGTTGGGGAGGG + Intergenic
1071568929 10:86685961-86685983 CTGGGGTTGGTGACGGTGGCGGG + Intronic
1071754950 10:88527240-88527262 CTGGGGATGGGGAAGGTTGCTGG - Intronic
1071876137 10:89845274-89845296 CGGGGGAGGGGACTGGTGGACGG + Intergenic
1072108022 10:92291830-92291852 TTGGGGAGGGGGAAGGGGGAGGG - Intronic
1072379750 10:94855950-94855972 ATGGGGTGGGGGATGGGGGAGGG - Intergenic
1072450658 10:95537096-95537118 GTGGGGATGGGGATGGGTGGAGG - Intronic
1072955226 10:99882203-99882225 CAGAGGCTGGGGGTGGTGGAAGG + Intronic
1073146753 10:101286146-101286168 CTGGGGGTGGGGGTGGGGGGTGG + Intergenic
1073423080 10:103440066-103440088 CTGTTGTTGGGGATGGTGGAGGG + Intronic
1074119296 10:110481529-110481551 GTGGGGTGGGGGATGGAGGAGGG - Intergenic
1074128255 10:110548198-110548220 CAGGGGATGGGGGTGGCGGAGGG - Intergenic
1074558407 10:114513054-114513076 CTGGGGAAAGGGAGGATGGATGG - Intronic
1074680270 10:115899098-115899120 GTGGGGTGGGGGATGGGGGAAGG - Intronic
1074755332 10:116620485-116620507 TTGGGGGTGGGGTAGGTGGAGGG - Intergenic
1074853122 10:117454550-117454572 CTGGGGAAGGGGATGGCTGTGGG + Intergenic
1074902718 10:117833027-117833049 GTGGGGAGGGGGAGGGAGGAGGG - Intergenic
1074991819 10:118715697-118715719 CTGGGGACGAGGATGGGGGTAGG - Intronic
1075046638 10:119151416-119151438 CTGGGGGTGGGGGTGGGGGTGGG + Intronic
1075382402 10:122029912-122029934 CAGGGGGTGGGGAGGGTGGGAGG + Intronic
1075439530 10:122468504-122468526 CTGGGGATGAGGTGGGTGGGTGG + Intronic
1075784822 10:125041968-125041990 TTGGGGGTGGGGGTGGGGGAGGG + Intronic
1075929407 10:126282862-126282884 CTGGGGCTGGGGGTGGGGGATGG + Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076088893 10:127661653-127661675 GTGGGGTTGGGGAAGGGGGAGGG - Intergenic
1076288019 10:129320431-129320453 CCAGGAATGGGGATGGGGGAAGG - Intergenic
1076312539 10:129518561-129518583 CTGGGGAGGGGGAGGGGGAAGGG - Intronic
1076336598 10:129710581-129710603 AAGGGGAGGTGGATGGTGGATGG + Intronic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076596953 10:131629279-131629301 CTGGGGGTGGGGCTGAGGGAAGG + Intergenic
1076621225 10:131789435-131789457 CTGGGGGTGGGGATGGTTTGGGG - Intergenic
1076705120 10:132297248-132297270 CTGGGGATGGCCACGGAGGAGGG - Intronic
1076760971 10:132605489-132605511 CTGGGGATGGGGAGGGGACAGGG + Intronic
1076886974 10:133267467-133267489 CTGGAGCTGGGGGTGCTGGAGGG - Intronic
1076996873 11:301662-301684 CTGGGGGTGGGGGGGGTGGGGGG + Intergenic
1077159474 11:1106174-1106196 TTGGGTAGGTGGATGGTGGATGG - Intergenic
1077260040 11:1612536-1612558 CTGGTGATGGGGGTGGGGGCTGG - Intergenic
1077282654 11:1752691-1752713 CTTGGGATGGGGAAGGAGGGTGG - Intronic
1077294250 11:1817156-1817178 CAGGGGCTGGGGGAGGTGGAGGG + Intergenic
1077299986 11:1842319-1842341 CTGGGCACGGGGAGCGTGGAGGG + Intergenic
1077465810 11:2733201-2733223 CTGGGGGTGGGGGTGGGGGTGGG - Intronic
1077488028 11:2848005-2848027 GAGGGGATGGGGCTGGGGGATGG + Exonic
1078133738 11:8635432-8635454 CTGGGGTTGGGCAGGGTGGAGGG - Intronic
1078309520 11:10226471-10226493 GTGGGGTTGGGGAGGGGGGAGGG - Intronic
1078447686 11:11416885-11416907 CTGGGGGAGGGGATGGGGCAGGG - Intronic
1078523080 11:12078897-12078919 TTGGGGAGTGGGATGGGGGAGGG - Intergenic
1078584685 11:12572846-12572868 CTTGGAATGGTGATGGTGGGAGG + Intergenic
1078600633 11:12727294-12727316 CTGTGGGTGGGGATGCTGGATGG + Intronic
1078639410 11:13081232-13081254 ATGGGGATGGTGATGATGGTAGG + Intergenic
1079045692 11:17100665-17100687 GTAGGAAGGGGGATGGTGGATGG - Intronic
1079079882 11:17406839-17406861 TTGGGAGTGGGGATGGGGGAAGG - Intronic
1079083116 11:17427828-17427850 ATGGGGAGGGGCATGCTGGAGGG + Intronic
1079130887 11:17746348-17746370 CTGTGGTTGTGGATGGTGGGTGG - Intronic
1079131188 11:17747793-17747815 CTGGGGCTGGCCAGGGTGGAAGG - Intronic
1079224875 11:18596359-18596381 CTGGGCATGGGTGTGATGGATGG - Intergenic
1079321781 11:19457469-19457491 CTGGGAAGAGGGATGGAGGAGGG + Intronic
1079331892 11:19540556-19540578 CAGGGGATGGGGAGGGTTGGAGG - Intronic
1079338585 11:19593148-19593170 CAGGGGCTGGGGGTGGCGGAAGG - Intronic
1079460990 11:20677719-20677741 TTGGGGGTGGGGTTGGGGGAAGG + Intronic
1080001638 11:27356925-27356947 GTGGGGTTGGGGGTGGTGGGGGG + Intronic
1080540302 11:33258029-33258051 CTGGGGATGCGGATGGGGCACGG - Intronic
1080749282 11:35138149-35138171 GTGGAGAAGAGGATGGTGGATGG + Intergenic
1080881614 11:36326682-36326704 GTGGGGATGGGGGTGGGGGTGGG - Intronic
1081000188 11:37659739-37659761 GTGGGGTGGGGGAGGGTGGAGGG + Intergenic
1081409706 11:42743210-42743232 CTGGGAGTGGGCATGGTGGTGGG - Intergenic
1081428116 11:42947515-42947537 ATGGGGATGATGATGGTGAAAGG + Intergenic
1081698139 11:45132977-45132999 TTGGGGATGGGGATGGGGATGGG - Intronic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1081997360 11:47374206-47374228 CTGGGGATGGAGTTGGGGGAGGG + Intronic
1082016823 11:47495370-47495392 TTAGGAATGGGGATGGGGGAAGG + Intronic
1082114531 11:48313963-48313985 TTGGGGGTGGGGCTGGTGGGAGG + Intergenic
1082882702 11:58053864-58053886 CTGGTGGTTGGGATGGGGGATGG - Intronic
1083126485 11:60572605-60572627 GTGGGGTGGGGGATGGGGGAGGG - Intergenic
1083292959 11:61699924-61699946 GTGGGGCTGGGGAGGGTGGCAGG + Intronic
1083389233 11:62335959-62335981 CTGAGGCTGGGGAAGGTGGCTGG - Intergenic
1083443134 11:62690021-62690043 CAGAGGAGGGGGATGGTGTAGGG - Intergenic
1083481280 11:62949215-62949237 CTGTGGATGGGGATGGCAGCAGG + Intronic
1083490022 11:63009217-63009239 CTGGGGATTGGGATGAAGGAGGG + Intronic
1083564968 11:63706441-63706463 CTGTGGATGGCTAAGGTGGAAGG - Intronic
1083581534 11:63828269-63828291 CTGGGCATGGGCATGGTGGTGGG - Intergenic
1083638375 11:64132428-64132450 CTGGGGGTGGGGCGGGGGGAGGG + Intronic
1083663980 11:64265008-64265030 CTGGGGGTGGGGTTTGAGGACGG - Exonic
1083727551 11:64636393-64636415 CTGGGGGTGGGGGTGGGGGTGGG + Intronic
1083997262 11:66278549-66278571 CTGGGGCTGGGGCTGGGGGCGGG + Intronic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084408267 11:68991465-68991487 TGGGGGATGGGGAAGGTGGCAGG - Intergenic
1084421849 11:69064279-69064301 CGGGGGATAGGGAGGGGGGAGGG - Intronic
1084443436 11:69189499-69189521 CTGGGGATGGGGGTGCAGGAGGG + Intergenic
1084525789 11:69697287-69697309 CAGGGATTAGGGATGGTGGAGGG - Intergenic
1084525967 11:69698173-69698195 GTGGGGAAGGGGCTGGTGGGGGG - Intergenic
1084689967 11:70719434-70719456 CTGGGGATGAGGATGGAGCTGGG + Intronic
1084805004 11:71572688-71572710 GTGGGTCTGGGGATGGTGGTGGG - Intergenic
1084872595 11:72108224-72108246 CTGGGGACTGTGATGCTGGATGG + Intronic
1084942074 11:72618278-72618300 CTGGGAGTGGGGAGGCTGGAGGG - Intronic
1084971379 11:72774094-72774116 CAGGGGCAGGAGATGGTGGAGGG + Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085256231 11:75175120-75175142 CTGGGGATGGGGAGTGGGGAGGG + Intronic
1085286381 11:75364427-75364449 CTGGGCATGGGCATGGTGTTGGG - Intergenic
1085309021 11:75505331-75505353 CTGGGGGTGGGGCTGGGGGCCGG - Intronic
1085393467 11:76194417-76194439 CTGAGGATGAGGATGGTGCGAGG + Intronic
1085531170 11:77192895-77192917 ATGGTGTTGGTGATGGTGGAGGG + Intronic
1085536986 11:77227732-77227754 TTGGGGGTGGGGTTGGGGGAGGG - Intronic
1085665426 11:78411158-78411180 TTGGGGGGGGGGATGGTGGAAGG + Intronic
1086162034 11:83732807-83732829 CTGGGGAGGGGAATGGGGGAAGG + Intronic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1087304605 11:96473418-96473440 CTGAGGATGGGGATGTCAGATGG - Intronic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087529041 11:99355558-99355580 CTGTGGATGATGGTGGTGGAGGG + Intronic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1087651666 11:100875378-100875400 CTAGGGGTGGGGATGGGGAAAGG + Intronic
1088759793 11:112918590-112918612 ATGGGGATGGGGATGGGGATAGG - Intergenic
1088759795 11:112918596-112918618 ATGGGGATGGGGATGGGGATGGG - Intergenic
1088759798 11:112918602-112918624 ATGGGGATGGGGATGGGGATGGG - Intergenic
1088759801 11:112918608-112918630 ATGGGGATGGGGATGGGGATGGG - Intergenic
1089016067 11:115166460-115166482 ATGGGGCTGGGGAAGGAGGAGGG + Intergenic
1089042244 11:115462952-115462974 CTAGGGAAGGGGATGGTGACTGG + Intronic
1089064275 11:115650580-115650602 AAGGGGAGGGGGACGGTGGATGG - Intergenic
1089100186 11:115956674-115956696 GTGGGGTTGGGGTTGGGGGAAGG - Intergenic
1089214904 11:116829525-116829547 CAGGGCTTGGGGCTGGTGGAGGG + Intergenic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089307225 11:117534208-117534230 CTTGTGCTTGGGATGGTGGAGGG - Intronic
1089378699 11:118012684-118012706 TTGGGGATGGGGCAGGGGGAGGG + Intergenic
1089647320 11:119888869-119888891 CTGGTGAGGTGGGTGGTGGAAGG + Intergenic
1089710426 11:120310619-120310641 CTGGGGATGGTGATGGTTGAAGG + Intronic
1089752518 11:120661437-120661459 CTGGGGGTGGGGTTGGGGGTGGG + Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090381960 11:126333657-126333679 CTGGGGCTTGGGCTGCTGGAGGG + Intronic
1090417336 11:126549588-126549610 CTGGGGAGAGGGCTGGGGGAGGG + Intronic
1090417854 11:126552965-126552987 CTGGGGAAGAGGATGTGGGAAGG - Intronic
1090851924 11:130578462-130578484 ATGGGAACTGGGATGGTGGAAGG - Intergenic
1091269138 11:134293362-134293384 TTTGGGATGGGGAAGGAGGAGGG + Intronic
1091379159 12:44757-44779 TTGGGGATGGGGATGGAAGTGGG - Intergenic
1091531222 12:1357843-1357865 CTGGGGATGAAGTTGGAGGAGGG - Intronic
1091614599 12:2039918-2039940 CTGGAGATGGGGATGGGGGTAGG + Intronic
1091662286 12:2393365-2393387 CTGGAGCAGGAGATGGTGGAGGG - Intronic
1091667126 12:2427260-2427282 ACGGGGATGGGGATGGTAGTGGG + Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1091872738 12:3908473-3908495 GTGGGGAAGGAGATGGGGGAAGG - Intergenic
1091917948 12:4282723-4282745 CTGGGGAGGGGGCTGGTTGGAGG - Intronic
1091941149 12:4483703-4483725 GTGGTGATGGGGATGGGGGAGGG - Intergenic
1092059173 12:5534659-5534681 CTGGAGATGGGGGTAGTGGTAGG - Intronic
1092140167 12:6178337-6178359 TTGGGCATGGGGATGGTGGGAGG - Intergenic
1092140787 12:6182095-6182117 CAGGGGATGGGGACAGGGGATGG + Intergenic
1092181327 12:6448935-6448957 CTGGGGCTGGGGTTGGTTGGGGG - Intronic
1092184653 12:6470204-6470226 CGGGGGCTGGGGGTGGTGGATGG - Intronic
1092290784 12:7158424-7158446 CTGGGGCTGGGGCTGGGGGTGGG + Exonic
1092599093 12:10039174-10039196 CTGTGCATGGGGATGGTTGTCGG + Intronic
1092696632 12:11178359-11178381 GTGGGGATGGGGAGGGTCAAGGG + Intergenic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1093015491 12:14150707-14150729 CTGGAGATGGGGTTGGGGGGGGG - Intergenic
1093104086 12:15065454-15065476 CTGGGGATGGGGATGTCAGGTGG + Intergenic
1093411824 12:18877126-18877148 CAGGGCATAGGGATGGAGGAAGG + Intergenic
1093623483 12:21320159-21320181 CTGGAGGTGTGGAAGGTGGAAGG - Intronic
1093661957 12:21767561-21767583 TGGGGGATGGGGATGGTGTGGGG - Intronic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1095048958 12:37540753-37540775 CTGGGGCTGGGGCTGGTTGCAGG + Intergenic
1095499851 12:42825482-42825504 CTGGGGATGGGGCTGCTGAGTGG + Intergenic
1095690594 12:45084255-45084277 CTGGGGGGTGGGGTGGTGGAGGG - Intergenic
1095825307 12:46524800-46524822 CTGGGGATGGAGATGGGAGGAGG + Intergenic
1096196471 12:49651933-49651955 CTGGTAATGGGGGAGGTGGAGGG + Exonic
1096255315 12:50058656-50058678 CTGGAGATGAGGATTCTGGATGG + Intronic
1096382798 12:51173068-51173090 CTGGGGCGGCGGACGGTGGAAGG - Intronic
1096463600 12:51836360-51836382 ATGAGGATGAGGATGGTGGGCGG - Intergenic
1096499148 12:52054908-52054930 CTGGGGCTGGGGCCGGTGGGAGG - Exonic
1096578898 12:52571840-52571862 CTGGGGAGGGGGCTGGTGCCTGG - Intronic
1096602322 12:52738180-52738202 CGGGGGGTGGGGAGGGGGGAGGG + Intergenic
1096657924 12:53103313-53103335 CTGGGCATCTGGATGGTGGTTGG + Intergenic
1096671290 12:53199678-53199700 GTGGGGATGGGGTTGGGGGATGG - Intronic
1096750259 12:53754105-53754127 GTGGGGATGGGGATGGATAATGG + Intergenic
1096812756 12:54182274-54182296 CTGGGGGTGCGGCTGGTGGTGGG - Exonic
1096857870 12:54498136-54498158 CTGGGGATGGGGGTGAGGGTGGG + Intronic
1097051992 12:56229230-56229252 CTTGGGATGTGGTTGGTGGCAGG - Exonic
1097280241 12:57840756-57840778 GGGGGGATGGGGGTGGGGGAAGG + Intronic
1097637139 12:62136980-62137002 CTGGGGATGGGGGTGGAGGATGG - Intronic
1097802375 12:63928652-63928674 CTGGGGGTGGGGGCGGTGGTGGG + Intronic
1098122178 12:67253452-67253474 CTGGGGATGAGGATGGAGAGAGG - Intergenic
1098319677 12:69230888-69230910 CAGGGGAGGGGCCTGGTGGAAGG - Intergenic
1098618698 12:72563797-72563819 CTGGGGGCGGGGGTGGGGGATGG + Intronic
1099011701 12:77298885-77298907 GTGGGGATAGAGATAGTGGAAGG - Intergenic
1099819813 12:87695673-87695695 GTGGGGTGGGGGATGGGGGAGGG - Intergenic
1099938037 12:89151394-89151416 CTCAGAATGGGGAGGGTGGAAGG + Intergenic
1100324823 12:93530963-93530985 CTGGGGTTGGGGATGGTTTGGGG + Intergenic
1100325222 12:93533817-93533839 CTGCAAAGGGGGATGGTGGATGG + Intergenic
1100388926 12:94130046-94130068 GTGGGGTTGGGGAGGGAGGAGGG - Intergenic
1100874291 12:98945976-98945998 AAGGGGATGGAGAAGGTGGATGG - Intronic
1101075334 12:101123464-101123486 TTGGGGGTGGGGGTGGGGGAAGG - Intronic
1101270460 12:103138280-103138302 CAGGGGAGGGGACTGGTGGAAGG + Intergenic
1101443567 12:104721162-104721184 ATGGGGATGGGGATGGGGCCAGG - Intronic
1101674597 12:106906536-106906558 GTGTGGTTGGGGATGGTGGGTGG - Intergenic
1101703658 12:107199431-107199453 TGGGGGATGGGGATGGTTAATGG - Intergenic
1101744949 12:107532337-107532359 CTGGGGACAAGGATGCTGGATGG - Intronic
1101874411 12:108589248-108589270 CTGGAGGTGGGGTCGGTGGAGGG + Intergenic
1101916444 12:108899737-108899759 CTGGGAGTGGGGATGGTAGCTGG + Intronic
1101967297 12:109290404-109290426 CTGGGGACGGGCAGGTTGGAGGG - Intronic
1102080531 12:110094318-110094340 ATGGGGGTGCGGATGGTGGTGGG + Intergenic
1102247223 12:111362996-111363018 CTGGGGCTGGGGCTGGGGCAGGG + Exonic
1102259583 12:111436042-111436064 CTGGGGACAGGGCAGGTGGATGG + Intronic
1102391048 12:112548863-112548885 CGCGGGATGGTGATGGTGTAGGG + Intergenic
1102473681 12:113175004-113175026 CTGGGGGTGGAGATGGGGGCTGG - Intronic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1102654469 12:114469909-114469931 CTGGGGATGGGGGTGGGAGAAGG - Intergenic
1102789706 12:115634789-115634811 CCGGGGATGGGGAGAGTGGTAGG - Intergenic
1102886832 12:116528569-116528591 TTGGGGGTGGGGATAATGGAGGG - Intergenic
1103011804 12:117463771-117463793 GTGGGGATGGGAATGGTGGAAGG + Exonic
1103191656 12:119006832-119006854 CTGGAGATGGGCATGGTGGTGGG + Intronic
1103253198 12:119518712-119518734 TTGGTGGTGGGGATGGTGGTGGG + Intronic
1103347965 12:120264150-120264172 CTGGAGCTGGGGTTGGTGTAGGG - Intronic
1103350345 12:120279035-120279057 AGGGGGAGGGGGATGGGGGAGGG + Intergenic
1103606140 12:122087388-122087410 CTGGGGCTGGGGAGGGTGGGTGG + Intronic
1103900339 12:124300549-124300571 CTGGGGTTGGGAAGGATGGATGG + Intronic
1103985885 12:124767226-124767248 CTGGGGATGTGGTTGCGGGAGGG - Intergenic
1104045585 12:125160314-125160336 GTAGGGATGGGGATGGGGGGAGG + Intergenic
1104287171 12:127433909-127433931 CTGGGGGTGGGGACGTTGGAAGG - Intergenic
1104656083 12:130574963-130574985 CTGGGGGTGGGGGTGGCGGTGGG - Intronic
1104915219 12:132260883-132260905 CTTAGGAGGGGGATGGTGGAGGG + Intronic
1104979108 12:132565279-132565301 CTGGGAATGGCGGGGGTGGAGGG - Intronic
1105214764 13:18277719-18277741 CTGGGGGTGGGGCGGGGGGAGGG + Intergenic
1105527359 13:21188296-21188318 ATGGGGATGATGATGGAGGAGGG - Intergenic
1105546615 13:21355449-21355471 CTGGGGAGGGGGAGGAGGGAAGG + Intergenic
1105640997 13:22264033-22264055 TTGTGGGTGGGGATGGCGGAAGG + Intergenic
1106020709 13:25912379-25912401 CAGAGGCTGGGGATGGGGGATGG + Intronic
1106259747 13:28056069-28056091 CTGGGGTTGGGGGTGGAGTAAGG - Intronic
1106348870 13:28908283-28908305 GTGGGGTTGGGGGAGGTGGAAGG - Intronic
1106484563 13:30160885-30160907 ATGGGGTTGGGGATGATGGCTGG - Intergenic
1107008981 13:35648859-35648881 ATGGGGGTGGGGGTGGTGGGAGG + Intronic
1107017713 13:35721099-35721121 CTGGGGACTGGGATGATGCACGG + Intergenic
1107112545 13:36713454-36713476 CAGAGGCTGGGGAGGGTGGAGGG - Intergenic
1107139614 13:36983813-36983835 CAAGGGATGGGGATGGATGATGG + Intronic
1107528996 13:41263787-41263809 GCGGGGATGGAGATGGTGGGAGG + Intergenic
1107802580 13:44123209-44123231 GTGGGGTTGGGGAGGGCGGAGGG - Intergenic
1107822143 13:44295840-44295862 CTGGGGCTTGGGATGGAGAAGGG - Intergenic
1108104750 13:46997263-46997285 TAGGGAGTGGGGATGGTGGAGGG - Intergenic
1108171041 13:47742185-47742207 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1108308770 13:49165509-49165531 CTGGGGATGGGGATGTGAGGTGG + Intronic
1108501297 13:51072185-51072207 CTGGGGATGGGGGTGGGGTGGGG - Intergenic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1108687718 13:52835271-52835293 ATGGGGAGGGGGAGGGGGGAAGG + Intergenic
1108689811 13:52850371-52850393 CTGGGGAGGGGGATGATGAGTGG + Intergenic
1108750093 13:53439818-53439840 GGGGGGAGGGGGATGGGGGAGGG - Intergenic
1108860607 13:54854118-54854140 GTGGGGATGGGGGTGGGGGAGGG - Intergenic
1108962449 13:56251679-56251701 TTGGGGATGGGTAGGGAGGATGG - Intergenic
1109157489 13:58928748-58928770 CAGGGGTTGGGGAGGGTGGGAGG + Intergenic
1109309111 13:60671767-60671789 CTTTGCATGGGGATGGGGGATGG + Intergenic
1109317514 13:60767752-60767774 CTGGGGATTGAGATGGTGGTGGG - Intergenic
1109483322 13:62985534-62985556 CTGGGGAAGAGGCTTGTGGATGG - Intergenic
1109867497 13:68284407-68284429 CTTGGGGTGGGGAGGGGGGAGGG + Intergenic
1110657763 13:78020441-78020463 CTTTGGATAGGGATGGTGAAAGG + Intergenic
1111580803 13:90220658-90220680 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
1111868787 13:93803887-93803909 CTGGGGTGGGGAATGGTAGAGGG + Intronic
1112802814 13:103131555-103131577 CGGGGGATGGGGGTGGCGGGGGG - Intergenic
1113082607 13:106534705-106534727 CGGGGGTTGGGGGTGGGGGACGG + Intronic
1113159591 13:107364972-107364994 AGGGGGATGGGGAAGGGGGAGGG - Intronic
1113264186 13:108598995-108599017 CTGGGGATGGGGTGGGGGGAGGG - Intronic
1113357169 13:109591850-109591872 CTGGGGATAAGGAAGGTGTAGGG + Intergenic
1113432447 13:110262318-110262340 CTGGGAAGGCTGATGGTGGAGGG - Intronic
1113483938 13:110641154-110641176 CTGGGGATGGGTGAGGTGGGTGG - Intergenic
1113849142 13:113408022-113408044 CTGGGTCTGGGGCTGGTGGCTGG + Intergenic
1113902327 13:113804040-113804062 TGGGGGCTGGGGAAGGTGGAGGG + Intronic
1113976401 13:114231074-114231096 CTGGAGGTGGGGCTGGTGGGAGG + Intergenic
1113976419 13:114231131-114231153 CTGGCGGTGGGGCTGGTGGGAGG + Intergenic
1113976435 13:114231188-114231210 CTGGAGGTGGGGCTGGTGGGAGG + Intergenic
1113976451 13:114231245-114231267 CTGGCGGTGGGGCTGGTGGGAGG + Intergenic
1113976469 13:114231302-114231324 CTGGAGGTGGGGCTGGTGGGAGG + Intergenic
1113976487 13:114231359-114231381 CTGGAGGTGGGGCTGGTGGGAGG + Intergenic
1113976505 13:114231416-114231438 CTGGCGGTGGGGCTGGTGGGAGG + Intergenic
1113976521 13:114231473-114231495 CTGGAGGTGGGGCTGGTGGGAGG + Intergenic
1114371029 14:22088216-22088238 GTGGGGTGGGGGATGGGGGAGGG + Intergenic
1114549878 14:23526554-23526576 CTGGAGATGGGGCTGGAGAAGGG + Exonic
1114777333 14:25498659-25498681 CTGGGGTGGGGGAGGGGGGATGG + Intergenic
1114860345 14:26510565-26510587 TGAGGGTTGGGGATGGTGGATGG + Intronic
1114900198 14:27047947-27047969 GTGGGGTGGGGGATGGGGGAGGG + Intergenic
1115011686 14:28555765-28555787 GTGGGCATGGGGGAGGTGGAAGG + Intergenic
1115488290 14:33934181-33934203 CTGGGAATGGGGATGGTGGGAGG - Intronic
1115498548 14:34029610-34029632 CTGGGGGTGGCGATGTTGGGGGG - Intronic
1115518142 14:34205960-34205982 GTGGAGCTAGGGATGGTGGAGGG - Intronic
1115578587 14:34735971-34735993 CTGGTGAGGGGGATGGTGGTAGG - Intergenic
1115698158 14:35922949-35922971 ATGGGGTGGGGGATGGGGGAGGG + Intronic
1115782278 14:36783199-36783221 CTTGGGGTGGGGGTGGTGGGGGG + Intronic
1116149150 14:41116452-41116474 CTGATGTGGGGGATGGTGGAGGG - Intergenic
1116397053 14:44459021-44459043 CGGGGTAGGGGGCTGGTGGAAGG + Intergenic
1116422719 14:44751762-44751784 TTGGAGATGGGGCTGGTGGGAGG + Intergenic
1116502678 14:45639361-45639383 CTGGGGTTGGGGTTGGAGGACGG + Intergenic
1116520398 14:45839777-45839799 TTGGGGGTGGGGATGTTGGGAGG - Intergenic
1116715187 14:48417748-48417770 CTGGGGATGGGGTTGCAAGATGG + Intergenic
1116724371 14:48544074-48544096 GTGGGGAGGGGGATGGGGGGAGG - Intergenic
1117411877 14:55457334-55457356 TTGGGGTTGGGGGTGGAGGAGGG + Intergenic
1117547578 14:56805715-56805737 GTGGGGGTGGGGATGGGGGTGGG - Intronic
1117703426 14:58438501-58438523 CTGGGGTTGGGAATGGTAGCAGG - Intronic
1118096759 14:62546153-62546175 GTGGGGGTGGGGAGGGGGGAGGG - Intergenic
1118513822 14:66505857-66505879 ATGGAGATGGGGAGGGTTGATGG - Intergenic
1118610561 14:67536300-67536322 CTGGGGATGAGGCTGGGAGAAGG - Intronic
1118849760 14:69574323-69574345 CTGGGGATGGAGAAGGTGCCTGG + Intronic
1119326827 14:73764823-73764845 CTGGGGAGGGGGCAGGTGGGAGG - Intronic
1119480868 14:74956816-74956838 CTGGGCCTGGGGCTGGTGGGTGG + Intergenic
1119484071 14:74977032-74977054 CTGGTGGTGGGGATGATGGTGGG + Intergenic
1119548983 14:75494340-75494362 TTGGGGGTGGGGATGGGGCAAGG + Intergenic
1119654844 14:76409778-76409800 TGGGGGATGGGGATGGGAGATGG + Intronic
1120586934 14:86323087-86323109 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1120854891 14:89203683-89203705 CTGGGGCTGGACAAGGTGGAGGG + Intronic
1121001896 14:90456930-90456952 CCGGGGATGGGGAAGGAGGGAGG + Intergenic
1121273290 14:92651883-92651905 CTGGGGGAGGGGGTGGTGGGCGG - Exonic
1121325432 14:93016920-93016942 CTGGAGATGGGGCAGGAGGAGGG + Intronic
1121432933 14:93900196-93900218 CTGGGAGTGGGGGTGGTGGACGG + Intergenic
1121449471 14:93998252-93998274 CTGGGGCTGGGGCTGGGGCAGGG - Intergenic
1121732379 14:96195448-96195470 CTTGGGAGGGGGAAGGTGCAGGG + Intergenic
1121738667 14:96236316-96236338 GTGGGGATGGGGATGGCTGTTGG - Intronic
1122006479 14:98708487-98708509 GAGGAGATGGGGATGGTTGATGG - Intergenic
1122018888 14:98820130-98820152 CTGGGGCTGGGGGTGGAGGCAGG - Intergenic
1122151522 14:99728552-99728574 CTGGAAATGGAGAGGGTGGAGGG - Intergenic
1122154549 14:99742378-99742400 CTGGGGATGGAGAAGGTACATGG + Intronic
1122230859 14:100305845-100305867 CAACGGATGGGGATGGGGGAGGG + Intronic
1122246284 14:100405511-100405533 CAGGGGATGGGGAGGGAGGCTGG + Intronic
1122373707 14:101243999-101244021 CAGGGGATGGGGATGGGGTTGGG - Intergenic
1122437407 14:101709508-101709530 CAGGGGTGGGGGATGGGGGAGGG + Intergenic
1122534356 14:102451906-102451928 CTGGGGATGGGGCCGGGGGGTGG - Intronic
1122703946 14:103608476-103608498 CTGGGGATGGGCATGCAGGCTGG - Intronic
1122741731 14:103875470-103875492 GTGGGGGTGGGGTGGGTGGATGG + Intergenic
1122855760 14:104559424-104559446 CTGGAGATGGGGATGGAGGGAGG - Intronic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1122920020 14:104876165-104876187 CTGGGGCAGGGGATGGAGCAGGG + Intronic
1122972431 14:105157896-105157918 CTGAGGATGAGGAGGGTGGTGGG - Intronic
1123061212 14:105595296-105595318 CTGGTGATGGGGTGGATGGAGGG + Intergenic
1123085667 14:105716207-105716229 CTGGTGATGGGGTGGATGGAGGG + Intergenic
1202902290 14_GL000194v1_random:50805-50827 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1123666565 15:22613146-22613168 CAGGGGATGGGGCAGGTGGTTGG + Intergenic
1123988444 15:25665485-25665507 CAGGGGTTGGGGGTGGTGGTGGG + Intergenic
1124011996 15:25846141-25846163 CAGGGGCTGGGCATGGGGGAAGG + Intronic
1124106167 15:26740137-26740159 GTGAGGATGGGGATGGTGGGGGG - Intronic
1124109722 15:26773811-26773833 CTGGGGGTGGGGGTGGGGGTAGG - Intronic
1124320408 15:28707719-28707741 CAGGGGATGGGGCAGGTGGTTGG + Intronic
1124343950 15:28908944-28908966 CGGGGGCTGGGGGAGGTGGAAGG - Intronic
1124482106 15:30087691-30087713 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124488564 15:30139791-30139813 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124521482 15:30409512-30409534 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124537179 15:30556707-30556729 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1124543650 15:30608763-30608785 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124754964 15:32398531-32398553 CAGGGGATGGGGCAGGTGGTTGG + Intronic
1124761474 15:32450884-32450906 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124777158 15:32598184-32598206 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1124987402 15:34634002-34634024 TGGGGGATGGGGGTGGGGGAGGG + Intergenic
1125129689 15:36268928-36268950 GTGGTGATGGGGTTGGGGGAGGG + Intergenic
1125523861 15:40363577-40363599 TTGGGGTGGGGGATGGTGGTGGG - Intronic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126544109 15:49853665-49853687 CTGGGGGTGAGGATGATGGGGGG + Intergenic
1126586690 15:50295763-50295785 TTGGGGGTGGGTGTGGTGGAGGG - Intronic
1126688489 15:51268253-51268275 CAGGGGATGGGTGTGGAGGAAGG - Intronic
1127114367 15:55709843-55709865 CTGGCGATGGGGAGGAGGGAGGG + Intronic
1127201607 15:56659701-56659723 CGGGGGATGGGGTTGTTGGTGGG - Intronic
1127292961 15:57586564-57586586 CTGGGTATGGGGATGGAGGGTGG - Intergenic
1127378443 15:58406758-58406780 GTGGGGATAGTGAGGGTGGAGGG - Intronic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1127774216 15:62253000-62253022 CTGGGGACTGGGCTGGGGGAAGG - Intergenic
1128101058 15:65000322-65000344 GTGGGGATGGGGATGGGGGGAGG - Intergenic
1128116780 15:65112503-65112525 CTGGGCATGGGGATGGGGAGTGG + Intronic
1128227057 15:66009336-66009358 ATGGGGGTGGGGAGGGTGCAGGG + Intronic
1128229131 15:66022753-66022775 CTGGGGTTGGGGGTGGAGGGTGG + Intronic
1128302508 15:66575402-66575424 CTGGGGTTGGTGCGGGTGGAGGG + Intergenic
1128317447 15:66670041-66670063 CTGGGTCTGGGGATTGGGGATGG + Intronic
1128325261 15:66719906-66719928 CTGGGGAGGGGGGTGGTGGAGGG + Intronic
1128378270 15:67092649-67092671 CTGGGGGTAGGAGTGGTGGAGGG + Intronic
1128576748 15:68781373-68781395 GGGGGGGTGGGGATGGGGGAGGG - Intronic
1128582359 15:68818826-68818848 CTGGGTGTGGTGATGGGGGAGGG - Intronic
1128614620 15:69099446-69099468 AGGGGGATGGGGGTGGAGGAAGG + Intergenic
1128778828 15:70344655-70344677 CTGGGGATGGGCAATGGGGAAGG - Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129232376 15:74203897-74203919 CTCAGGATGGGGATGGGGGTGGG + Intronic
1129446883 15:75625236-75625258 AGGGGGAAGGGGATGGGGGAGGG - Intronic
1129475321 15:75781078-75781100 CAGGGGATGGGGCTGCTGGTTGG - Intergenic
1129577254 15:76763340-76763362 CTGGGGTGGGGGGTGGTGGGGGG + Intronic
1129697578 15:77749377-77749399 CTGGAGATGGGGCTGGTGGGAGG - Intronic
1130109796 15:80954612-80954634 TTGGGGGAGGGGATGGAGGAAGG + Intronic
1130380350 15:83366588-83366610 CTGGGGATGGGGGTGGTGGCGGG + Intergenic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1130689582 15:86070143-86070165 GTGGGGTGGGGGATGGTGGAGGG - Intergenic
1130939263 15:88494199-88494221 CTGGGGAAGGGTATGGGGTAGGG - Intergenic
1131832549 15:96363018-96363040 CTGGGGCTGAGGTTGGGGGAGGG + Intergenic
1131878558 15:96837823-96837845 CTGGGGATGGTGATGAGGGACGG + Intergenic
1131898400 15:97059927-97059949 TTGGGGATGAGGATGGTAGTGGG - Intergenic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132198181 15:99929454-99929476 CTGGCTTTGGGGATGGAGGACGG + Intergenic
1132296176 15:100736387-100736409 CTGGGGACGGGGAATGGGGATGG - Intergenic
1132448341 15:101950362-101950384 TTGGGGATGGGGATGGAAGTGGG + Intergenic
1132484466 16:183278-183300 CTGGAGATGTGGAGGTTGGAGGG + Intergenic
1132520203 16:383776-383798 GTGGGGATGGGGATGGCCGCAGG + Intronic
1132579857 16:679914-679936 CTGCGGATGGGGCTGGGGGCGGG + Intronic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132643075 16:986801-986823 CTGGGGGTGGGGGTGGGGGCCGG + Exonic
1132829003 16:1918484-1918506 CGGGGGAGGGGGAGGGGGGAGGG - Intergenic
1132983403 16:2751058-2751080 CAGGAGATGGGGGTGGTGGGGGG + Intergenic
1133039434 16:3052541-3052563 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133043277 16:3072174-3072196 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133084188 16:3349105-3349127 TGGGGGAGGGGGGTGGTGGAAGG - Intergenic
1133232565 16:4373421-4373443 ATGGGGATGGGGCTGGGGGCTGG + Intronic
1133398796 16:5469665-5469687 CAGGGGCTGGGGATGGAGGAAGG - Intergenic
1133621596 16:7531895-7531917 CTGGGGAAGGGGATGGGTTAGGG - Intronic
1133635010 16:7656949-7656971 CTGGGGGTGTGGGTGGAGGAGGG - Intronic
1133857474 16:9563307-9563329 CTGGGGCTGGGGATGGGAAAAGG + Intergenic
1133970543 16:10564689-10564711 CTGAGAATGGTGGTGGTGGATGG - Intronic
1134036886 16:11037781-11037803 CTGGGGGTGGGGGTGGGGGTGGG - Intronic
1134070600 16:11257229-11257251 CCGGGGCTTGGGATGGTGGGCGG + Intronic
1134219014 16:12338775-12338797 CTGGGGGTGGGGATGGGGTAGGG - Intronic
1134240576 16:12503098-12503120 CTGGGGGTGGGGGTGGTGGATGG - Intronic
1134296584 16:12951620-12951642 CTGGGGATGGCGGTGGGGGAGGG + Intronic
1134414240 16:14029989-14030011 CTGGGCATGGGGAGGGGGGAGGG + Intergenic
1134420093 16:14078763-14078785 CTGGTGATGGAGATGGTGAAAGG + Intronic
1134993654 16:18722497-18722519 ATGGGGAGGGGGAGGGGGGAGGG + Intergenic
1135177424 16:20242900-20242922 CTGGGAATTGGGATGGAGGATGG + Intergenic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135524732 16:23205754-23205776 CTGGGGATGGAACAGGTGGATGG - Intronic
1135710394 16:24711487-24711509 CTGGGGATGGGGAGATTGCAGGG - Intergenic
1135737134 16:24940735-24940757 TTGGGGAAGGGAATGGTGGCTGG + Intronic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136073867 16:27805002-27805024 CTGGGATTGGGGGTGGGGGAGGG + Intronic
1136110711 16:28062636-28062658 CTGGGGGTGGGGGTGATGCAGGG - Intronic
1136116064 16:28095562-28095584 CTGAGGAAGGGGATGGGGAAAGG - Intergenic
1136144317 16:28307028-28307050 CTGGGGCTGGGGCTGCTGGAGGG - Intronic
1136247923 16:28985812-28985834 TTGGGGATGGGGCTGGAAGATGG - Intronic
1136272181 16:29154898-29154920 CCAGGGCTGGGGATGGTGGGTGG + Intergenic
1136395115 16:29988250-29988272 CTGGGGCCAGGGGTGGTGGAGGG + Exonic
1136478665 16:30527740-30527762 CAGGCGCTGGGGAAGGTGGAGGG - Intronic
1136544404 16:30947587-30947609 CAGGGGCTGGGGGAGGTGGAAGG + Exonic
1137367518 16:47873606-47873628 CTGCTGATGTGGGTGGTGGAGGG - Intergenic
1137942491 16:52702603-52702625 CAGGGGAGGAGGAGGGTGGATGG - Intergenic
1138009186 16:53361988-53362010 CAGGGGATGGGGCAGGTGGTTGG + Intergenic
1138303060 16:55948720-55948742 CTAGGGATGGTGATGGTGGCTGG + Intronic
1138371237 16:56528170-56528192 GGGGAGATGGGGATGGTGAATGG + Intergenic
1138437550 16:57012677-57012699 CGGGGGTTGGGGTTGGGGGATGG - Intronic
1138585038 16:57964039-57964061 CTGGGGATGGGGGTGGGGATGGG - Intronic
1139344443 16:66293508-66293530 CTGGGGGTGGGGGTGGTGATGGG - Intergenic
1139411411 16:66764015-66764037 CTGGGGATGGGAAGGGTTGCAGG + Intronic
1139459129 16:67108239-67108261 CGGGGGAGGGGGGTGGTGGGTGG + Intergenic
1139651350 16:68363749-68363771 CTGGGGCTGGGGGAGGAGGATGG - Intronic
1139958903 16:70706449-70706471 CTGGGGATGGAAATGAAGGAAGG - Intronic
1140031342 16:71341555-71341577 CTCTGGATGGGGATGGAGGGGGG + Intergenic
1140194956 16:72848138-72848160 CTGGGGATGGGGGTGCTGAGGGG + Intronic
1140279763 16:73543827-73543849 CTGGAGAAGGGGGTGGGGGAGGG + Intergenic
1140450988 16:75070663-75070685 CTGGGAAGGGGTATGGTGGGCGG - Intronic
1140546996 16:75820327-75820349 CTGCAGATGGGCATGGTGGAAGG + Intergenic
1141055783 16:80812477-80812499 CTAGGGATGGGGGTGGGGGGTGG - Intergenic
1141266991 16:82506674-82506696 CTGGAGATGGGGAGGGGCGAAGG - Intergenic
1141296240 16:82772348-82772370 TAGGGGATGTGGATGGTGCAGGG + Intronic
1141560228 16:84862924-84862946 GTGGGGATGGGGATGGAAGAAGG + Intronic
1141629081 16:85277080-85277102 CTGGGGAAGGAGCTGGGGGAGGG + Intergenic
1141635242 16:85310897-85310919 CAGGGGCTGGGGATGGAGGGGGG + Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141720788 16:85754200-85754222 CTTGGGGTGGGGCTGGTGGCGGG + Intergenic
1141732986 16:85834741-85834763 CTGGGAATGGGGATGGGGATGGG + Intergenic
1141732989 16:85834747-85834769 ATGGGGATGGGGATGGGGATGGG + Intergenic
1141732992 16:85834753-85834775 ATGGGGATGGGGATGGGGATGGG + Intergenic
1141875260 16:86819809-86819831 CTGGGGGTGGGGGTGGGGGTGGG - Intergenic
1141973072 16:87495790-87495812 TGGGAGATGGGGATGGGGGAGGG - Intergenic
1142112412 16:88339588-88339610 AGGGGGATGGGGATGGTGGCAGG + Intergenic
1142140409 16:88470257-88470279 CTGGGGACAGGGCTGCTGGACGG + Intronic
1142182227 16:88676897-88676919 TCGCTGATGGGGATGGTGGAAGG - Intergenic
1142199057 16:88752614-88752636 CTGAGGATGGAGATGAGGGAGGG + Intronic
1142250866 16:88991248-88991270 CGAGGGATGGGGATGGTGGCTGG + Intergenic
1142294915 16:89214493-89214515 CAGAGGATGGGGTTGGTGGAAGG + Intergenic
1142323765 16:89401092-89401114 CTGGGGAGGGGGAGGGCGGGTGG - Intronic
1142342680 16:89534156-89534178 CTGGGGATGGAGAATGGGGAGGG - Intronic
1142479587 17:210648-210670 CTGCTGCTCGGGATGGTGGAGGG + Intergenic
1142534813 17:606841-606863 CAGGGGATGGGGGTAGGGGATGG - Intronic
1142558057 17:793072-793094 GTGGGGATGGGGTGGGTGGGTGG + Intergenic
1142728161 17:1831477-1831499 CTGTGGATGGGAATGGTGGCAGG - Intronic
1142748738 17:1974712-1974734 GTGGGGGTGGGGAGGGGGGAGGG + Intronic
1142759617 17:2035052-2035074 TTGGGGAAGGGGGTGGAGGAGGG + Intronic
1143135427 17:4710185-4710207 CTGGGAAGGAGGATGGTGGGGGG - Intergenic
1143150331 17:4803868-4803890 ATGTGGCTGGGGATGGTGGCGGG - Intergenic
1143476383 17:7205845-7205867 ATGGGGATGGGGATTGAGGATGG - Intronic
1143543987 17:7585764-7585786 CTGGGGCTGGGCATTGTGGCTGG + Exonic
1143544406 17:7588018-7588040 CTGGGGTGGGGGAAGGGGGACGG + Exonic
1143595547 17:7911665-7911687 CAAGGGGTGGGGAAGGTGGAGGG - Exonic
1143632293 17:8146209-8146231 AAGGGGAAGGGGATGGTGGTAGG + Intronic
1143648513 17:8248078-8248100 TTGGGGGTGGGGATGGGGGTGGG + Intronic
1143727635 17:8860420-8860442 CTGGGGATGGGGATGGATTCGGG - Intronic
1143913999 17:10275573-10275595 CTGGGGGTGGGGATCATGGGAGG + Intergenic
1143914443 17:10278658-10278680 CTGGAAATGGAGTTGGTGGACGG + Intergenic
1143974493 17:10820047-10820069 CTGGGGATGGGAATGAAGGTAGG + Intergenic
1144343595 17:14331289-14331311 CTGGGGGTGGGGGTGGAGGGAGG - Intronic
1144649614 17:16999037-16999059 CAGGGGCTGGGGAAGGGGGAAGG - Intergenic
1144754745 17:17672347-17672369 CGGGGGATCAGGAGGGTGGAGGG + Intergenic
1144767889 17:17742816-17742838 CTGGGGACAGGGATGGCCGAGGG - Intronic
1144816871 17:18040614-18040636 CTGGGGGTGGAGAAGCTGGAAGG - Intronic
1144858611 17:18285406-18285428 CTGGGCATGGGACTTGTGGAAGG - Exonic
1145014084 17:19385574-19385596 TTGGGGGTGGGGAGGGTGGTGGG + Intronic
1145252064 17:21302051-21302073 CTGGGGCTGGGGCTGGTGCTGGG + Intronic
1145826921 17:27884043-27884065 CTGGGGATGGGGACGTCGGGAGG - Intronic
1145936698 17:28718304-28718326 TCGGGGGTGAGGATGGTGGAGGG + Intronic
1146063826 17:29620603-29620625 CTTGGGATGTGGATGGTCAAGGG + Intronic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146280268 17:31540130-31540152 CTAGAGAGGGGGATAGTGGAGGG + Intergenic
1146514132 17:33475798-33475820 CAGGGGATGGGGATGGGGGAGGG - Intronic
1146622700 17:34411849-34411871 CCTGGGATGGGGGTGGGGGAAGG + Intergenic
1146663956 17:34684190-34684212 GTTGGGGTGGGGATGGGGGAGGG - Intergenic
1146688184 17:34855859-34855881 CTGGGGTTGGGGTTGTTGGCAGG - Intergenic
1146688406 17:34856856-34856878 ATGGGGGTGGGGAGGATGGAGGG + Intergenic
1146802965 17:35842010-35842032 CTGGGGAAGGAGATGGTGTCAGG - Intronic
1146836877 17:36118221-36118243 CTGGGGGTGGGGGCGGTGGGGGG - Intergenic
1146908599 17:36633490-36633512 TTGGGCAGGGGGATGGAGGAAGG + Intergenic
1146910653 17:36646433-36646455 AGGGGGATGGACATGGTGGAGGG + Intergenic
1146942265 17:36851646-36851668 CAGGGGGTGGGGATGGGGCAGGG - Intergenic
1147192982 17:38748123-38748145 CTGGGGATTGGGATGGGGGCCGG - Intronic
1147249234 17:39143354-39143376 CTGGGGAGTGGGCTGGGGGAAGG - Intronic
1147447060 17:40480867-40480889 CTGGAGATGGGGGTGGAGGTGGG - Intronic
1148082415 17:44974863-44974885 TTGGGGATGGGGATGGAGTAGGG + Intergenic
1148186848 17:45650555-45650577 CTGGGGAGGGGGAGGATGGGGGG + Intergenic
1148217377 17:45840413-45840435 GTGGGGGTGGGGAGGGTGGCGGG + Intergenic
1148382391 17:47209488-47209510 CTGGGGCAGGGGCTGGTGCAGGG - Exonic
1148437254 17:47694207-47694229 CTGGGGCTAGGGCTGGGGGAGGG + Intronic
1148464761 17:47858164-47858186 CTGGGGCTGAGGATGGGGGCCGG - Intergenic
1148560331 17:48602383-48602405 GTGGGGGTGGGGATGGCGGTGGG + Intronic
1148612313 17:48972499-48972521 AGGGGGATGGGGATGGTGGTGGG - Intergenic
1148680425 17:49470428-49470450 CTGGGGATCGGGGTGGGGGAGGG + Intronic
1148682562 17:49483098-49483120 CTGGGGAGGGGGCTGCTGGGAGG - Intergenic
1148738057 17:49875841-49875863 GTGGGGGTGGGGCAGGTGGAAGG + Intergenic
1148757981 17:49984552-49984574 CTGGGGATGGGAACAGTGGGTGG - Intergenic
1148770625 17:50064054-50064076 CTGGGGATAGGGACGGAGGTGGG - Intronic
1148793102 17:50184651-50184673 CTGGGGGCGGGGATGGGGGCAGG - Exonic
1148836780 17:50469688-50469710 CTAGGGTTGGGGATGAGGGATGG - Intronic
1149053961 17:52340368-52340390 GTGGGGATGGGGATGGTTAATGG - Intergenic
1149287087 17:55176912-55176934 GTGAGGGTGGGGCTGGTGGAAGG - Intergenic
1149450740 17:56748206-56748228 CTGGGGGTGGGGGTAGAGGAAGG - Intergenic
1149493448 17:57101426-57101448 CGGGGGTTGGGGGTGGTGGAGGG - Intronic
1149602272 17:57900631-57900653 ATGGTGATGATGATGGTGGAAGG - Intronic
1150007670 17:61479683-61479705 CTGGGGTTGGGGAGGAGGGAAGG + Intronic
1150130640 17:62666986-62667008 CTGGGGAGGGGGGTGGAGGTCGG - Intronic
1150273684 17:63882491-63882513 GTGGGGATGGGGGTGGGGGTGGG + Intergenic
1150281345 17:63931199-63931221 CTGGGGATGGGAATCCTGGATGG + Intronic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150837281 17:68575958-68575980 CTGGGGAAGTGGATGGTGTTAGG + Intronic
1151175207 17:72282433-72282455 CTGGGGATGTGGAGGGTGTGCGG - Intergenic
1151278048 17:73050790-73050812 CTGGGGATGGGGGAGGTGAAAGG + Intronic
1151285668 17:73109238-73109260 CAGGGGATGGGGATGGGAGGTGG - Intergenic
1151365432 17:73613586-73613608 CTGGGGGTGGGGGTGGGGGTGGG - Intronic
1151394728 17:73815067-73815089 GTGGGGATGGGGATGGTTTTGGG + Intergenic
1151520977 17:74629318-74629340 GTGGGGAGGGGGAGGGGGGAGGG + Intergenic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1151635594 17:75345698-75345720 CTGGGGGTGGGGGTGGGGGTGGG - Intronic
1151716372 17:75833092-75833114 CAGGGGAAGGGGATGGGGGTGGG - Intronic
1151720827 17:75855086-75855108 CTGGGGGCGGGGTTGGAGGAAGG - Intronic
1151965713 17:77430198-77430220 CTGGGGATGGAGCTGGCGGGGGG - Intronic
1151995714 17:77607738-77607760 ATGGGGATGGGGGAGGTGCAAGG + Intergenic
1152077611 17:78168919-78168941 CTGGGGGTGGGGTGGGTGGCGGG - Intronic
1152190260 17:78883806-78883828 CTGGGGTTGGGGAGGGCGGCAGG - Intronic
1152210786 17:79001958-79001980 GTGGGGCTGGGGAGGGAGGAGGG - Intronic
1152238388 17:79149977-79149999 GTGGGGATGGGGATGGGGGTGGG + Intronic
1152238392 17:79149983-79150005 ATGGGGATGGGGGTGGGGGTGGG + Intronic
1152238395 17:79149989-79150011 ATGGGGGTGGGGGTGGGGGATGG + Intronic
1152250944 17:79212259-79212281 CTGGGGCTGGGGCTGGGGCAGGG + Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152370204 17:79883103-79883125 CTGGGGGTGGGGGTGGGGGTAGG - Intergenic
1152391513 17:80006501-80006523 CGGGGGATGGGGATGGGGCAAGG + Intronic
1152550523 17:81027757-81027779 CTGGAGCTGGGCAGGGTGGAGGG - Intergenic
1152553728 17:81042715-81042737 ATGGGGGTGGGGATGGTGGTGGG + Intronic
1152599201 17:81253036-81253058 CTGGGGGTGCGGATGGGGAAGGG - Intronic
1152636593 17:81432830-81432852 CTGGGGATGGGGGGGGAGGGTGG - Intronic
1152636621 17:81432879-81432901 CTGGGGATGGGGGGGGAGGTTGG - Intronic
1152659499 17:81535749-81535771 ATGGGGATGAGGATGGTGAGGGG - Intronic
1152659508 17:81535773-81535795 ATGGGGATGAGGATGGTGAGGGG - Intronic
1152659524 17:81535824-81535846 ATGGGGATGGGGATGGAGAGGGG - Intronic
1152659537 17:81535860-81535882 ATGGGGATGGGGATGGAGAGGGG - Intronic
1152755385 17:82084980-82085002 CTGGGGATGGGGAGGCTGGTGGG + Intronic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1153010256 18:532196-532218 GTGGGGCTGGGGATGGAGGCAGG + Intergenic
1153058217 18:968887-968909 CAGGGGATGGGGCTAGGGGAGGG - Intergenic
1153586487 18:6626059-6626081 CTCTGGATGGAGATGGTGGATGG + Intergenic
1153769080 18:8401033-8401055 CTGGGGGTGGGGAGAGGGGATGG - Intronic
1154024833 18:10697280-10697302 CTGGGGATGGAAGTGGTGCATGG - Intronic
1154336703 18:13471635-13471657 GTGGAGCTGGGGAGGGTGGAGGG + Intronic
1154501753 18:15000916-15000938 CTGGGGGTGGGCAGGGCGGAGGG + Intergenic
1154978394 18:21481224-21481246 CTGGGCAGGGGGATGGGGGCAGG + Intronic
1155060418 18:22223486-22223508 GTGGGGATGCGGATAGTGGGTGG + Intergenic
1155329462 18:24699874-24699896 ATGGGGATGGGGATGGGGGTAGG + Intergenic
1155526508 18:26721314-26721336 CTGGGGATGGGGATGGAGGCAGG + Intergenic
1155776628 18:29771196-29771218 AAGGGGATAGGGATGGTAGAAGG + Intergenic
1156036437 18:32771498-32771520 GTGGGGGTGGCGGTGGTGGAAGG - Intronic
1156472206 18:37384384-37384406 CTGGGGATGAGGACAGGGGAGGG + Intronic
1156493700 18:37511939-37511961 CTGGGGGTGGGGATAGAGGAGGG + Intronic
1156519614 18:37711119-37711141 CTGGGGTGGGAGATGGGGGATGG + Intergenic
1156738353 18:40292256-40292278 GGGGGGATGGGGAGGGAGGAAGG - Intergenic
1156876643 18:42022281-42022303 ATGGGGTTGGGGATGGGGGCAGG - Intronic
1157091588 18:44643242-44643264 CTGGGGAAGGTGCTGATGGAAGG + Intergenic
1157257695 18:46153248-46153270 CTGAGGAAGGGGCTGGGGGAGGG + Intergenic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157294301 18:46431514-46431536 CTGGGGCTGTGGAGGGTGCAGGG + Intronic
1157335430 18:46734031-46734053 CTGGACCTGGGGATGGTGGAGGG - Intronic
1157446415 18:47749588-47749610 TTGGGCATGGGGTTGATGGAGGG + Intergenic
1157468830 18:47971895-47971917 CAGGGGATGGGGTAGGGGGAAGG - Intergenic
1157518021 18:48324782-48324804 GTTGGGCTGGGGATGGTGGCAGG + Intronic
1157682063 18:49615075-49615097 CTGGGGATGGGCCTGGTGAGAGG - Intergenic
1157710551 18:49847076-49847098 CTGGGGATGGAGATGGGAGCGGG + Intronic
1157712991 18:49862890-49862912 CTGGGGAGGGGGGTGGGGGGTGG - Intronic
1157881900 18:51328721-51328743 CTGGCGTTGAGGATGGAGGAAGG - Intergenic
1158312206 18:56170971-56170993 CTGGGGTTGGGGAGGGGGAAAGG + Intergenic
1158468369 18:57712280-57712302 CTGGTGCTGGGGCTGGGGGAGGG - Intronic
1158478877 18:57803357-57803379 CTGGGGCTGGGGCTGGAGGCGGG + Intergenic
1158721952 18:59933009-59933031 CTGGGGATGGGGACTGGGGAGGG - Intergenic
1159590763 18:70332721-70332743 TTGGGGGTGGGGAGGGTAGAGGG - Intergenic
1159637276 18:70820687-70820709 CTTGGGATGGGGGTGGCGGTGGG + Intergenic
1159916603 18:74193770-74193792 GTGGAGGGGGGGATGGTGGAGGG - Intergenic
1160068618 18:75604110-75604132 CTGGGGTTGGGGGTGGCAGAAGG + Intergenic
1160404823 18:78638146-78638168 CTGGGGCTGGGGAGGGCGGCTGG + Intergenic
1160461642 18:79043411-79043433 GTGGGGGTTGGGATGGGGGATGG - Intergenic
1160563889 18:79775052-79775074 CTGGGGAGAGGGTTGGTGGAAGG + Intergenic
1160636926 19:82191-82213 TTGGGGATGGGGATGGAAGTGGG - Intergenic
1160724861 19:613577-613599 CCGGGGATGGGGATGGGGATGGG + Intronic
1160724864 19:613583-613605 ATGGGGATGGGGATGGGGATGGG + Intronic
1160724867 19:613589-613611 ATGGGGATGGGGATGGGGCCGGG + Intronic
1160724877 19:613607-613629 CCGGGGATGGGGATGGGGATGGG + Intronic
1160724880 19:613613-613635 ATGGGGATGGGGATGGGGATGGG + Intronic
1160724883 19:613619-613641 ATGGGGATGGGGATGGGGCCGGG + Intronic
1160724893 19:613637-613659 CCGGGGATGGGGATGGGGATGGG + Intronic
1160724896 19:613643-613665 ATGGGGATGGGGATGGGGCCGGG + Intronic
1160724906 19:613661-613683 CCGGGGATGGGGATGGGGCCGGG + Intronic
1160844804 19:1161498-1161520 CTGGGGGTGGAGATGGGGGTGGG + Intronic
1160848988 19:1180670-1180692 CTGGGGAAGTGGGTGGAGGAAGG - Intronic
1161054202 19:2181757-2181779 CTGGGGCTGGGGCTGGTGCTGGG - Intronic
1161149874 19:2702207-2702229 CTGGGGAGGGGGCTGGAGGTGGG - Intronic
1161311285 19:3595584-3595606 CAGGGGCTGGGGGTGCTGGATGG - Intronic
1161448262 19:4329811-4329833 CTGGGGGTGGGGGAGGGGGAGGG - Intronic
1161448266 19:4329817-4329839 TTGGGGCTGGGGGTGGGGGAGGG - Intronic
1161821325 19:6532848-6532870 CCCGGGGTGGGGATGGTGGGGGG - Intronic
1161845452 19:6709613-6709635 CTGGGGCTGGGGGAGGTGGGTGG - Intronic
1161846343 19:6713736-6713758 CTGGGAGTGGGGAAGGTGGGGGG - Intronic
1161846389 19:6713831-6713853 CTGGGGGTGGGGAAGGTGGGGGG - Intronic
1161872113 19:6878240-6878262 CTGGGGATGGGGATGGGATGAGG - Intergenic
1161928963 19:7323408-7323430 CAGGGGCTGGGGAGGGGGGATGG - Intergenic
1162110784 19:8398526-8398548 CTGGGGACAGGGGTGGTGGGAGG + Intronic
1162184833 19:8896813-8896835 GTGGGGCTGGGGACGGGGGATGG + Exonic
1162185255 19:8899974-8899996 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186055 19:8905986-8906008 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162187382 19:8916542-8916564 GTGGGGCTGGGGCTGGAGGATGG + Exonic
1162205900 19:9055801-9055823 CTGGGGATGGGGAAGCCGGGAGG - Intergenic
1162302815 19:9853803-9853825 CTGGGGGTGGGGGTGGGGGTGGG + Exonic
1162344539 19:10111622-10111644 CTGGGGATGGGGCTGGGGCAGGG + Exonic
1162345320 19:10115130-10115152 CTGGGGTAGGGGAGGGTGGCAGG + Exonic
1162736135 19:12748143-12748165 GAGGGGGTGGGGAGGGTGGAGGG - Exonic
1162789012 19:13053590-13053612 TTGGGAATGAGGATGGAGGATGG - Intronic
1162947991 19:14055049-14055071 GTGGGGATGGGGCTGGGGCATGG + Exonic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1162963756 19:14145542-14145564 GTGGATATGGGGATGGGGGAGGG + Intergenic
1162982490 19:14248614-14248636 CTGGGGAGGGGGAGAGGGGATGG - Intergenic
1163004589 19:14389307-14389329 AAGGGGAGGGGGATGGGGGAGGG + Intronic
1163058416 19:14740137-14740159 ATGGGAATGTGGAAGGTGGATGG + Intronic
1163089744 19:15011402-15011424 CTGGGGTTGGGCGTGGGGGAGGG - Intronic
1163112422 19:15169823-15169845 CTGGGGAGGGGCAGGATGGAGGG + Intronic
1163112964 19:15172506-15172528 ATTGGGATGTGGGTGGTGGAAGG - Intronic
1163115220 19:15185080-15185102 CTGGGGTTGGGGGAGGTGGGGGG - Intronic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1163376156 19:16931736-16931758 CTGGGGATGGGGAAGCCAGATGG - Intronic
1163441199 19:17323554-17323576 CTGGGGCTGGGGCTAGGGGAGGG + Exonic
1163499797 19:17669510-17669532 CTGGGGCTGGGGCTGGGTGAAGG + Intronic
1163699013 19:18777839-18777861 CACGGGCTGGGGATGGCGGATGG - Exonic
1163807778 19:19410339-19410361 TGGGGGATGGGGGTGGTGGGTGG + Intronic
1164155274 19:22591991-22592013 ATGGGGATGGGGATGGTTTTGGG + Intergenic
1164229871 19:23277762-23277784 CTGGGGATGCGCTCGGTGGATGG - Intergenic
1164908363 19:31985695-31985717 CTGGGGACAGTGATGGTGGCAGG + Intergenic
1164977608 19:32585304-32585326 CTGGTGATGGGGACTGGGGATGG + Intronic
1164999702 19:32751098-32751120 CGGGGGGTGGGGAGGGGGGAGGG - Intronic
1165091552 19:33390756-33390778 CTGGGGATGAGGAGGCTGCAGGG + Intronic
1165159640 19:33808466-33808488 CAGGGGATGGGGGTGGCAGATGG + Intronic
1165246336 19:34500470-34500492 CTGGTGATGGGGTGGGTGGGAGG - Exonic
1165374339 19:35431267-35431289 CTGGGGGTGGAGGGGGTGGAGGG - Intergenic
1165431581 19:35776097-35776119 CTGGGGATGGAGCGGGTGGGGGG - Intronic
1165709938 19:38003892-38003914 CTGGGGGTGGGGGTGGGGGATGG - Intronic
1165749367 19:38250981-38251003 CTGGGACTGGGGATGGGGGTGGG + Intronic
1165749371 19:38250987-38251009 CTGGGGATGGGGGTGGGGTGGGG + Intronic
1165903044 19:39177699-39177721 ATGGTGATTGAGATGGTGGACGG + Exonic
1165925002 19:39321096-39321118 CTGGGGGTGGGGCTGGGGAAGGG - Intergenic
1166044927 19:40224454-40224476 GTGGGGTTTGGGAGGGTGGATGG - Intronic
1166274476 19:41742837-41742859 CTGGTGATGGGGGAGGTGAAAGG + Intronic
1166279370 19:41780774-41780796 CTGGTGATGGGGGAGGTGGAAGG + Intergenic
1166327736 19:42061655-42061677 GTGGGGCTAGGGATGGTGCAAGG - Intronic
1166552526 19:43675777-43675799 CTGGGGATAGAGATGGAGGTGGG + Intergenic
1166746030 19:45142280-45142302 CTGGGGACGGGGAGGGGGCACGG - Intronic
1166758665 19:45211352-45211374 CTGGGTATGGTGGTGGTGGAGGG + Intronic
1167036048 19:46995561-46995583 CTGGTGATGGCAAAGGTGGATGG - Intronic
1167042731 19:47032261-47032283 CTGGGGCTGGGGCAGATGGAAGG - Exonic
1167055952 19:47111977-47111999 TCGGGGAAGGGGATGGGGGAGGG - Intronic
1167081576 19:47279746-47279768 AGGGTGATGGGGATGATGGAGGG + Intergenic
1167242260 19:48351407-48351429 CTGGGGATGGGGACGGGGCGGGG - Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167339102 19:48904295-48904317 GTGGGGATGGGGATGGGAGCAGG + Intronic
1167477515 19:49709468-49709490 TTGGGGATGGGGATGGAGGAGGG - Intronic
1167513762 19:49910715-49910737 GTGGGGGTGGGGGTGGGGGAGGG + Intronic
1167606205 19:50482222-50482244 GTGGGGGTGGGGGTGGTGGTGGG + Exonic
1167627718 19:50603788-50603810 CAGGGGATGGGGATGGCGACAGG - Intergenic
1167628077 19:50605682-50605704 CAGGGGATGGGGATGGCGACAGG - Intergenic
1167651415 19:50731805-50731827 CTGGCGAGGGGGATGGGAGAAGG - Intergenic
1167684656 19:50949201-50949223 CCGGGGGTGGGGATGGGGGTGGG - Intronic
1167980694 19:53272711-53272733 ACGGGGATGGGAATGGTGGAAGG + Intergenic
1168098583 19:54128968-54128990 CTGGGCTTCGGGCTGGTGGAGGG + Intronic
1168308552 19:55449855-55449877 CTGGGCAGGGGGCTGGTGGGGGG - Intergenic
1168405541 19:56108411-56108433 CTGGGCAGGGGCAGGGTGGAGGG - Intronic
1168467445 19:56614883-56614905 CTGGGGATGGGGGTTGAGGAAGG - Intronic
1168509788 19:56965378-56965400 CAGGGGCTGGGGAAGGGGGACGG - Intergenic
1168570470 19:57463457-57463479 CGAGGGATGGGGCTGGGGGAGGG + Intronic
1168672137 19:58248660-58248682 CAGGGGCTGGGGATGAGGGAGGG - Intronic
1168718906 19:58544294-58544316 GTGGGGTTGGCGGTGGTGGAAGG + Intronic
925004242 2:428828-428850 CTGGGGCTGGGCATGGCTGAGGG - Intergenic
925837504 2:7960227-7960249 CAAGGGATGGGGATGGTCGAGGG - Intergenic
925886044 2:8394432-8394454 CTGGGCAGGGGGAAGGTGAAGGG - Intergenic
926701531 2:15807427-15807449 GTGGGGGTGGGGATGGTGGTAGG - Intergenic
926702610 2:15813758-15813780 GTGGGGGTGGGGATGGGGGTGGG + Intergenic
926823538 2:16879733-16879755 CTGGGGAAGGGGATGGTTTTGGG + Intergenic
926862229 2:17321509-17321531 CTGGGGATGGGAAAAGGGGATGG - Intergenic
927177672 2:20421963-20421985 CTGGGCCTGGGGATGGTGGAGGG - Intergenic
927333744 2:21896343-21896365 CTGGGGAGGGGGAAGGTTGGGGG + Intergenic
927371556 2:22361468-22361490 ATGGGGATGGTGATGATGGTGGG - Intergenic
927440418 2:23112303-23112325 CAGGGGGTGGGGTTGGGGGAAGG - Intergenic
927710810 2:25324740-25324762 CTGGGGATGGATAAGGAGGAGGG + Intronic
927812322 2:26187050-26187072 CTGGGCTGGGGGATGCTGGAAGG + Intronic
927823017 2:26285677-26285699 CTGGGGGTGGGGAGTGGGGAGGG + Intronic
927878189 2:26672842-26672864 CTGGGGGTGACGGTGGTGGAAGG - Intergenic
927920357 2:26967513-26967535 CTGGGGCTGGGTGTGGTGGGTGG + Intergenic
927934536 2:27068914-27068936 TGGCTGATGGGGATGGTGGAGGG - Intronic
927996754 2:27492383-27492405 CTGGGGATAGGGATGGGGTCAGG - Exonic
928137262 2:28696936-28696958 CGTGGGATGGGGATTGTTGAAGG + Intergenic
928266894 2:29819827-29819849 TGGGGAATGTGGATGGTGGAAGG - Intronic
928275682 2:29898149-29898171 CTGGGGCTGGGGAAGGTGGCAGG - Intronic
928325992 2:30319965-30319987 CTGGAAATGGGGCTGGTAGATGG - Intronic
928337171 2:30407932-30407954 CAGGGGATGGGGGTATTGGATGG + Intergenic
928338548 2:30421233-30421255 GTGGGGGTGGGGATGCTGCAAGG - Intergenic
928428573 2:31199501-31199523 CTGGAGAATGGGCTGGTGGAAGG - Exonic
928836377 2:35551724-35551746 CAGGGGAAGGGCATGGTGGGAGG - Intergenic
928949934 2:36805509-36805531 GTGGTGGTGGTGATGGTGGATGG + Exonic
928951552 2:36817702-36817724 GTGGGGATGGGGATGGGGTGGGG - Intergenic
929542240 2:42831280-42831302 CTGGGGAAGGGGCTGGTGGTGGG + Intergenic
929736485 2:44555441-44555463 GTGAGGATGGGGAGGGAGGATGG + Intronic
929931090 2:46256028-46256050 ATGGGGATGAGGATGGAGCAAGG - Intergenic
930002252 2:46869321-46869343 CTGGAGTTGGGGACGCTGGAAGG - Intergenic
930024864 2:47023873-47023895 TAGGGGCTGGGGATGGTGGAAGG - Intronic
930198180 2:48529734-48529756 CTCTGGGTGGGGATGATGGAGGG - Intronic
930506494 2:52287996-52288018 TTGACAATGGGGATGGTGGAAGG - Intergenic
930565830 2:53019561-53019583 GTGGTGATGGTGATGGTGGTGGG + Intergenic
930593051 2:53353196-53353218 CTGAGGATTAAGATGGTGGATGG + Intergenic
931168693 2:59779011-59779033 CTGGGGATTGGGGGAGTGGAGGG + Intergenic
931198484 2:60075039-60075061 CTGGGGATGGGGAGGTGAGATGG - Intergenic
931218894 2:60271304-60271326 CTGGGTATGTGGATGGTGAATGG - Intergenic
931784530 2:65607498-65607520 AAGGGGATGAGGAGGGTGGAGGG + Intergenic
931828166 2:66022893-66022915 TTGGGGATGTGGGTGGTAGAGGG + Intergenic
932369317 2:71174470-71174492 CTGGGAGTGGGGTGGGTGGATGG - Intergenic
932425530 2:71631973-71631995 TTGGGGCAGGGGGTGGTGGAGGG - Intronic
932434903 2:71697454-71697476 CTGGGGTGGGGGATAGTGGGAGG + Intergenic
932434931 2:71697551-71697573 CTGGGGATGGGGATGCGGGTGGG + Intergenic
932612592 2:73210867-73210889 CTGGCGATGGAGCTGCTGGAAGG - Exonic
932618433 2:73251098-73251120 TTGGGGCTTGGGATGGAGGAAGG + Intronic
932930308 2:76028760-76028782 CAGAGGCTGGGGATGGTGGTGGG - Intergenic
933044805 2:77521942-77521964 GGGGGGATAGGGATGGGGGAGGG + Intronic
933078044 2:77954293-77954315 CAGGGGATGGGGATGGCGACAGG + Intergenic
933174128 2:79157601-79157623 CCGGGGCTTGAGATGGTGGAGGG + Exonic
933416727 2:81995852-81995874 ATGGGGATGGGGAGGATGAATGG - Intergenic
933529614 2:83490082-83490104 CTGGGGTTGGGGGAGGGGGAGGG + Intergenic
933529957 2:83496080-83496102 ATGGGGATGGGCATGGAGGTAGG + Intergenic
933555547 2:83826240-83826262 CTAGGGGTGGGGATTGGGGAGGG - Intergenic
933725136 2:85422528-85422550 CTGGGGATGGGGAGGTAGGAGGG + Intronic
933766986 2:85716398-85716420 CTGGGGGTGGGGATTGAGTAAGG + Intergenic
933769469 2:85733978-85734000 CTGGGGTGGGAGATGGTGGCAGG - Intergenic
933773151 2:85756182-85756204 GTGGGGGTGGGGGTGGGGGACGG + Intronic
934045515 2:88170264-88170286 CTGGGGATGGGGCGGGGGGCGGG - Intergenic
934077973 2:88443801-88443823 CGGGGGATGGAGAGGGTGGTGGG + Intergenic
934504378 2:94879603-94879625 CTGGGGATTGGGAGAGTGGCCGG + Intergenic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934781216 2:96970950-96970972 CTGGGGGTGGGGATGGGGGCAGG - Intronic
934992288 2:98930311-98930333 GTGGGGATGGGGATGGGGTAGGG - Intronic
934992303 2:98930349-98930371 GTGGGGACGGGGATGGGGTAGGG - Intronic
934992318 2:98930387-98930409 GTGGGGACGGGGATGGGGTAGGG - Intronic
934992333 2:98930425-98930447 GTGGGGACGGGGATGGGGTAGGG - Intronic
934992348 2:98930463-98930485 GTGGGGACGGGGATGGGGTAGGG - Intronic
934992363 2:98930501-98930523 GTGGGGATGGGGATGGAGTAGGG - Intronic
935033862 2:99348771-99348793 TTGGGGATGGGGACGGAGGAAGG + Intronic
935268812 2:101416190-101416212 CTGGGGAGGGGGGTGGAAGAAGG + Intronic
935755960 2:106276298-106276320 CTGGGGATGGGGCCTGTGAATGG - Intergenic
935945619 2:108283722-108283744 CTGTGGGTGGGAATGGGGGAAGG - Intergenic
936154585 2:110039831-110039853 CTGGGGATGGGGCAGGGGGAGGG + Intergenic
936190098 2:110331583-110331605 CTGGGGATGGGGCAGGGGGAGGG - Intergenic
936564550 2:113572850-113572872 TTGGGGATGGGGATGGAAGTGGG + Intergenic
936820891 2:116519418-116519440 CTGGGGATGGGTGTGGTGGTGGG + Intergenic
937046602 2:118855140-118855162 CTGGGGGTAGGGATGGGGTAGGG + Intergenic
937102382 2:119281914-119281936 GTGGGCCTGGGGATGGTTGAGGG - Intergenic
937135321 2:119546716-119546738 ATGGCGATGGGGATGGTGCTGGG - Intronic
937144812 2:119635499-119635521 CTGTGGATGGGTTGGGTGGATGG + Intronic
937209838 2:120261302-120261324 TTGGGCATGGTGGTGGTGGAGGG + Intronic
937221185 2:120344154-120344176 CTGGGGGTGGGGGTGGGGGTGGG + Intergenic
937222212 2:120348151-120348173 CTTGGGAGGGGCATGGTGGGAGG + Intronic
937229242 2:120387899-120387921 CTGGGCATGTGGTTGGTGGAAGG + Intergenic
937229411 2:120388892-120388914 GTGGGGATGGGGTGGGTGCAGGG + Intergenic
937263618 2:120601997-120602019 CTGGGCAGGGGCATGGTGGGTGG - Intergenic
937675839 2:124589194-124589216 CAGGGGCTGGGGGTGGTGGAGGG - Intronic
937811462 2:126204047-126204069 CAGGGCTTAGGGATGGTGGAGGG + Intergenic
937985027 2:127634573-127634595 CTGGGGAAGGGGAAGGTACAGGG - Intronic
938082009 2:128375032-128375054 CTGGCGCTGGGGAGGGTGGCAGG + Intergenic
938391489 2:130910055-130910077 CTGGGGGTGGGGTTAGGGGAGGG + Intronic
938500933 2:131831083-131831105 CTGGGGGTGGGCAAGGCGGAGGG + Intergenic
938546550 2:132337902-132337924 GTGGGGATGGGGGTGGGGGGTGG + Intergenic
938555855 2:132423620-132423642 CTGGGGAAGGGGATGGAAGTGGG - Intronic
939236642 2:139502769-139502791 CTTGGAATGGGGAGGGTAGAAGG + Intergenic
939361129 2:141174407-141174429 CAGGGGAGGGGCCTGGTGGAAGG + Intronic
939678677 2:145104123-145104145 CTGGGGGTGGGGAAGCTGGATGG - Intergenic
939925810 2:148172466-148172488 CTGGGGTTGGGGAAGGCAGAGGG + Intronic
939998062 2:148938660-148938682 CTGTGGCTGGGGAGGGTGAAGGG + Intronic
940008129 2:149028372-149028394 CTGGGCATGGGGAAGGGTGAAGG - Intergenic
940145640 2:150542434-150542456 AGGGGGATGGGGACGGTGGGGGG + Intergenic
940301890 2:152184337-152184359 CTGGGGATGGGGAGGTAGGTAGG - Intergenic
940306494 2:152232691-152232713 GTGGAGATGGGGAAAGTGGATGG - Intergenic
940977240 2:159959828-159959850 GTGGGAATGGGGATGGGTGAGGG - Intronic
941008719 2:160273706-160273728 TTGGGGATGGGGGTGGGGGAGGG - Exonic
941008723 2:160273712-160273734 TTGGGGTTGGGGATGGGGGTGGG - Exonic
941080880 2:161059275-161059297 CTGGAGGTTGGGATGGTAGATGG - Intergenic
941629249 2:167865968-167865990 ATGGGGAGGAGGATGGGGGAGGG - Intergenic
941941348 2:171041669-171041691 CTGGGGTGGGGGCTGGGGGATGG - Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942055535 2:172179026-172179048 CTGGGGATGGGGGGGATAGAGGG - Intergenic
942235814 2:173903997-173904019 CGGGGGGTGGGGATGGTTGTAGG + Intergenic
942505199 2:176634550-176634572 CTGGGGGTGGGGATGGTTGAAGG + Intergenic
942858863 2:180585761-180585783 CTGGGGTTGGGGAAGGGGGGAGG - Intergenic
943090966 2:183374528-183374550 GTGGGGGTGGGGATGGTTAATGG + Intergenic
943282217 2:185950043-185950065 CAGGGGTTGGGGGTGATGGAGGG - Intergenic
943292721 2:186095392-186095414 CTAGGGTTGGGATTGGTGGAGGG - Intergenic
943324837 2:186485895-186485917 CTCAGGATGGGGATGGTACAGGG + Intergenic
944249031 2:197562649-197562671 GTGGGGTGGGGGATGGGGGAGGG - Intergenic
944474778 2:200092488-200092510 GTGGGGATAGGGAGGATGGAGGG + Intergenic
944503111 2:200382180-200382202 CTGGGGAGGGGGATGGGGTGGGG - Intronic
944822046 2:203441026-203441048 CTGGGGTTGGGGGTGGAGGAGGG + Exonic
944897258 2:204177812-204177834 CTGGTGAGGGTGAGGGTGGAGGG + Intergenic
945033393 2:205685173-205685195 CTGGGGATTGGGATGGGAGGGGG - Intronic
945094062 2:206202685-206202707 GTGGGGATGGGGGAGGTGGGTGG + Intronic
945148935 2:206767676-206767698 CTGGGGATGGTAAATGTGGAAGG - Intronic
945579858 2:211579796-211579818 CAGGGGGTGGGGTTGGGGGAGGG + Intronic
946177334 2:217929650-217929672 GTGGAGATGGGGGTGGTGGCAGG - Intronic
946201025 2:218070876-218070898 CTGGGGAGAGGGATGGGGAAGGG - Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946301580 2:218827519-218827541 CTGGGGAAGGGGACTGTGGGAGG + Intronic
946382466 2:219358481-219358503 CTGGGGAGGCGGCTGGGGGAGGG - Intergenic
946415680 2:219538606-219538628 CTAGGGGTGGGGCTGGTGCAGGG - Exonic
946458852 2:219851592-219851614 CTGGGGGTGGGGGTGGGGGTGGG + Intergenic
946829798 2:223716978-223717000 CTGGGGATGTGCTCGGTGGATGG + Intergenic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
947136943 2:226984917-226984939 CTGGGGGTTGGGGTGGGGGAGGG + Intronic
947537309 2:230948299-230948321 CAGGAGATGGGGAGGGAGGAAGG - Intronic
947743208 2:232494379-232494401 CTGGGGAGGGGGATATTGGCAGG + Intergenic
947753212 2:232543474-232543496 TTGAGGATGGGGGGGGTGGATGG - Intronic
947820946 2:233069020-233069042 CTGGGGCTGAGGACGATGGAAGG + Intronic
947865655 2:233396787-233396809 TCGGGGATGGGGCAGGTGGAGGG + Intronic
947908074 2:233780203-233780225 CTGGGGTAGAGGATGTTGGAGGG + Intronic
948130807 2:235599381-235599403 CTGGGGAAGTGGATGCTGCAGGG + Intronic
948214926 2:236221571-236221593 CTGGGGAGGTGGAAGGTGAAAGG - Intronic
948355713 2:237375324-237375346 CTGGCAATGAGGATGGAGGATGG + Intronic
948465061 2:238148295-238148317 CTGGGGCTGGGGGTGGGGGTGGG + Intronic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948697336 2:239738251-239738273 CTGGGGATGGGGCTGGGGCTGGG - Intergenic
948771343 2:240252713-240252735 CTGGGGATGGAGACGGTGCCGGG + Intergenic
948800202 2:240430022-240430044 CTGGGGAGGGGGATGGGGGAAGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948840214 2:240645068-240645090 GTGGGACTGGGGATGGTGGTCGG + Intergenic
1168771809 20:420688-420710 ATGGGGGTGGGGCTGGGGGATGG - Intronic
1168904084 20:1390339-1390361 CTGGCCATGGGGAGGGGGGAGGG + Intronic
1168932181 20:1632742-1632764 CTGGGGCTGGTGTTGGGGGATGG - Intronic
1168980980 20:2003235-2003257 CTGGAGATGGGGGTGATGGCTGG + Intergenic
1169074201 20:2751563-2751585 CTTGGGCTGGGCCTGGTGGAGGG + Intronic
1169084970 20:2820917-2820939 GTGGGGCTGGGGGTGGGGGAGGG + Intergenic
1169153501 20:3308973-3308995 CTGGAGATGGGGCTTTTGGAAGG - Intronic
1169154238 20:3315890-3315912 CTGGACATGGACATGGTGGAAGG - Intronic
1169198650 20:3697040-3697062 CTGGGGACTTGGAGGGTGGAGGG - Intronic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1170057180 20:12219293-12219315 CTAGAGTTGGGGATGGGGGAAGG + Intergenic
1170131138 20:13021559-13021581 GTGGAGGTGGGGATGGTGGCGGG - Intronic
1170828098 20:19814369-19814391 CTGGGGAGGGGGTGGGAGGAGGG - Intergenic
1170931573 20:20773523-20773545 CAGGGGATGGGGATGAGAGATGG - Intergenic
1170984992 20:21249545-21249567 ATGGGGATGGTGATGATGGCAGG - Intergenic
1171175951 20:23050737-23050759 CTGTGGATGGGCAGGGTGGGGGG + Intergenic
1171206322 20:23284007-23284029 GTCGGGATGGGGGTGGGGGAGGG - Intergenic
1171370458 20:24658943-24658965 CTGGGGATGGAGATGCTGCTCGG - Intronic
1171531558 20:25856711-25856733 CTGGGGCTGGGGCTGGTGTTGGG - Intronic
1171543495 20:25984255-25984277 CTGGGGCTGGGGCTGGTTGCAGG + Intergenic
1171875414 20:30570634-30570656 GTGGGGATGGGGGTGGGGGGTGG + Intergenic
1172029982 20:31975043-31975065 CTGGGGAGTGGGAGGGCGGAGGG + Intronic
1172101166 20:32484403-32484425 GTGCGGATGGGGAAGGGGGAGGG - Intronic
1172577725 20:36022155-36022177 CCGGGCATGGTGATGGTGGCCGG - Intronic
1172757084 20:37293144-37293166 CTGGGGGTGGGGATGGTTTTGGG + Intronic
1172838536 20:37888219-37888241 CTGGGGATGTGGGTGGGTGATGG + Intergenic
1172881720 20:38204433-38204455 CTGGGGATAGGGGAGGTGGGAGG - Intergenic
1173118027 20:40264562-40264584 CTGGGGATTGGGATGGGACAGGG + Intergenic
1173345430 20:42195005-42195027 GTGGGGTGGGGGATGGGGGAGGG + Intronic
1173392286 20:42646071-42646093 ATGGGGATGGGTATAGTGGCTGG - Intronic
1173400825 20:42724472-42724494 TTGGGGTAGGGGATGGTGGAGGG - Intronic
1173590117 20:44218178-44218200 CTGTGGATGGGGCTGGAGGTGGG + Intergenic
1173736265 20:45363625-45363647 CTGTGGCTGGCGCTGGTGGACGG + Exonic
1173750044 20:45469661-45469683 GCGGGGAAGGGGAGGGTGGAGGG - Intergenic
1173847012 20:46194490-46194512 TTGGGTATGGGGCTGGAGGATGG + Intronic
1173969967 20:47145199-47145221 CAAGTGATGGGGATGGAGGAGGG + Intronic
1174026454 20:47580551-47580573 GGGGGGATGGGGGTGGGGGATGG - Intronic
1174054427 20:47788223-47788245 CTGGGGCCTGGGGTGGTGGAGGG + Intergenic
1174184065 20:48693218-48693240 CTGGGAAGGTGGATGATGGATGG - Intronic
1174188218 20:48721955-48721977 CTGGGGATGGAGGGGGTGGTGGG + Intronic
1174211437 20:48881909-48881931 CTGGGGGTGGGGGTGGGGAAAGG - Intergenic
1174273315 20:49385222-49385244 CTGGGTATGGGGATAGGGCAGGG - Intronic
1174476022 20:50795990-50796012 CTTGGGATGGGGATAGGGGACGG + Intronic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1174933450 20:54841662-54841684 TGGGGGATGGGGTTGGGGGAGGG - Intergenic
1175230373 20:57469934-57469956 CTGGGGGTGGGGTGGGTGGGGGG + Intergenic
1175332511 20:58175214-58175236 CTGGGGCGGGGGATGGAGGTGGG - Intergenic
1175349681 20:58309426-58309448 CTTGGGATGGGCATGGAGGCGGG + Intergenic
1175531380 20:59675809-59675831 CTGGGGAGGGGCCTGGTGCAGGG - Intronic
1175676731 20:60952612-60952634 CCAGTGATGGGGGTGGTGGAGGG + Intergenic
1175681814 20:60994790-60994812 CTGGGCAGTGGGATGGGGGAGGG - Intergenic
1175754877 20:61523130-61523152 CTAGGGAGAGGGATGGAGGATGG - Intronic
1175776266 20:61655741-61655763 CTGGGCATGGGGATGCTGCAGGG + Intronic
1175862023 20:62155668-62155690 CAGGAGATGGGGTTGGAGGAGGG - Intronic
1175876546 20:62232899-62232921 CTGGAGCTGGGGATGGGGGTTGG - Intronic
1175898226 20:62349641-62349663 CAGGGGATGGGGATGGGGATGGG + Intronic
1175919644 20:62444709-62444731 CAGGGGATGGGAGAGGTGGATGG + Intergenic
1175998635 20:62822224-62822246 CTGGGGAGGGGGAATGGGGAGGG - Intronic
1176041103 20:63066287-63066309 CTAGGGTTTGGGATGGGGGATGG + Intergenic
1176076542 20:63250929-63250951 CTGGGATGGGGGATGGGGGATGG - Intronic
1176182638 20:63758123-63758145 CTCTGGATGGGGCGGGTGGAGGG - Intronic
1176215426 20:63945504-63945526 CTGGGGTTGGGGTTGGGGTAGGG + Intronic
1176255111 20:64147658-64147680 CTGGGGAAGGAGATAGTGGGTGG + Intergenic
1176263232 20:64194340-64194362 GTAGGGATGGGGAGGGTGAATGG - Intronic
1176274478 20:64255945-64255967 CCGGGGGTGGGGAAGGAGGAGGG - Intronic
1176277300 20:64279657-64279679 CTGGGGATGGGGCTGGTGCTGGG + Intronic
1176389183 21:6154907-6154929 CTGGGGAGGGGGAAGGGGGCAGG - Intergenic
1176554026 21:8245313-8245335 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176572948 21:8428337-8428359 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176621658 21:9065572-9065594 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1177148673 21:17432933-17432955 TTGGGGCGGGGGATGGGGGATGG - Intergenic
1177369286 21:20180484-20180506 CTTGGGTGGGGGATGCTGGATGG + Intergenic
1177712421 21:24796212-24796234 GGGGGGATGGGGATGGTTAAGGG - Intergenic
1178013369 21:28313453-28313475 CTGGGGCTAGGGAAAGTGGAAGG - Intergenic
1178215541 21:30593263-30593285 CTTGGAGTGGGGATGGTGGGGGG - Intergenic
1178468348 21:32869481-32869503 ATGGGGATGGGGATGGAGATCGG - Intergenic
1178478970 21:32962592-32962614 GTGGGGGTGGGGATGGAGGTCGG + Intergenic
1178555384 21:33586395-33586417 TTGGGGGTAGGGGTGGTGGAGGG + Intronic
1178602137 21:34003898-34003920 CTGGGAATGGAGGTGGTGGGAGG + Intergenic
1178981244 21:37267204-37267226 CTGGGGGTGGGGATGGAGGTGGG - Intronic
1179030704 21:37717416-37717438 CTGGAGATGGGGTGGGTGTATGG + Intronic
1179050811 21:37887292-37887314 ATGAGGATGGGGCTGGGGGAGGG - Intronic
1179493716 21:41758246-41758268 CTGAGGATGGGGATGAGGGAAGG - Intronic
1179505133 21:41835000-41835022 CAGGAGATGTGGATGGAGGAGGG + Intronic
1179509261 21:41861660-41861682 CTGGGGATGAGCGGGGTGGAGGG - Exonic
1179569708 21:42271257-42271279 CAGGTGATGGGGCTGATGGAAGG - Intronic
1179607401 21:42525925-42525947 CAGAGGATGGGGATGGTAGCAGG + Intronic
1179633168 21:42691152-42691174 CTTTGGATGGTGATGGTGAAGGG - Intronic
1179633204 21:42691342-42691364 CTTTGGATGGTGATGGTGAAGGG - Intronic
1179633317 21:42691954-42691976 CTTTGGATGGAGATGGTGAAGGG - Intronic
1179674001 21:42969518-42969540 CTGGGGATGAGCACGGTGGATGG + Intergenic
1179734289 21:43383341-43383363 CTGGGGAGGGGGAAGGGGGCAGG + Intergenic
1179908067 21:44434387-44434409 CTGGTGGCGGGGATGGTGGCGGG + Intronic
1179949433 21:44701403-44701425 CTGGGGAGGGGGATGGTTTGGGG + Intronic
1180002636 21:45002158-45002180 CTGGGGAGGGGGTTGGGGAAGGG + Intergenic
1180031679 21:45213559-45213581 CTGGGGATGGGAATGGGGATCGG - Intronic
1180035318 21:45245404-45245426 CTGGGGATGGAGATGGTGTACGG - Intergenic
1180076040 21:45463342-45463364 ATGGGAATGGGGGTGGAGGATGG + Intronic
1180136688 21:45866626-45866648 CTGGGGAGGGGTCTGGTGGGAGG + Intronic
1180600001 22:17009348-17009370 GTGGGGATGGGGGTGCTGGGTGG + Intergenic
1181007196 22:20019518-20019540 CTGGGGGTGGGGATGGCCCAAGG + Intronic
1181079139 22:20402203-20402225 CAGTGGAGGGGGATGGAGGAGGG - Intronic
1181118676 22:20650632-20650654 AAGGGGATGGGGATGGGGGTGGG - Intergenic
1181172349 22:21016796-21016818 CTGGGGATGAGCTGGGTGGAGGG - Intronic
1181511912 22:23393100-23393122 CTGGGGCTGGGGCTGGGGCAGGG - Intergenic
1181528259 22:23502239-23502261 TGGGGGATAGGGATGGGGGATGG - Intergenic
1181528507 22:23502927-23502949 GGAGGGATGGGAATGGTGGATGG - Intergenic
1181528515 22:23502952-23502974 GGAGGGATGGGGATGGTGGAGGG - Intergenic
1181635117 22:24170877-24170899 CTGGTGCTGGGGAGGGTTGAAGG + Intronic
1181738627 22:24901982-24902004 TAGGGGATGGGGATGGTGGGTGG + Intronic
1181768926 22:25111766-25111788 CGGGGGATGGGGATGGGGGTGGG - Intronic
1182295949 22:29311362-29311384 CAGGGTATGTGGCTGGTGGACGG - Intronic
1182314046 22:29431520-29431542 CAGGGGATAGGGGTGTTGGAGGG + Intergenic
1182345232 22:29658614-29658636 GTGGGGGTGGGGATGGGGGTGGG - Intronic
1182355255 22:29719932-29719954 CTGGGGGTGGGGAGCGCGGAGGG + Intergenic
1182424957 22:30266919-30266941 GTGGGGATGGGGAGGGGGGAGGG + Intergenic
1182428250 22:30286099-30286121 CTGGGGAGGGAGATGGGTGATGG + Intronic
1182548405 22:31088619-31088641 CTGGGGCAGGGGATGGGGGCAGG + Intronic
1182659516 22:31915398-31915420 GTGGGGAAGGGGATGCTGGAGGG + Intergenic
1182883414 22:33753348-33753370 CTGGCCTTGGGGATGGAGGAAGG + Intronic
1182893521 22:33839380-33839402 TTGGAGATGGGGCTGGTGGAAGG - Intronic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183034908 22:35134232-35134254 GTGGGACTGGGGAGGGTGGAGGG - Intergenic
1183456406 22:37925524-37925546 ATGGGGATGGGGGTGGGAGAAGG + Intronic
1183503344 22:38194428-38194450 GTGGGCATGGGGATTCTGGAAGG + Intronic
1183571561 22:38656858-38656880 CTGGGGAAGGGGACGGAGGCCGG + Intronic
1183643946 22:39111499-39111521 CTGGGGACGCGCGTGGTGGATGG + Intergenic
1183648854 22:39142304-39142326 CTGGGGATGGGGATGGGGTTTGG - Intronic
1183676931 22:39304370-39304392 CTGGGGAGGGCCATGGTGGGAGG + Intergenic
1183788062 22:40043231-40043253 CAGGGGATGGGGATTTGGGACGG + Exonic
1184032341 22:41902525-41902547 CTGTCGATGGGGCTGGGGGAAGG - Intronic
1184098459 22:42329248-42329270 CTGGGGATGAGGATGGTTTATGG - Intronic
1184105597 22:42365867-42365889 CTGGGGGTGGGGATTGTGGTAGG - Intergenic
1184194290 22:42916401-42916423 GTGGGGGTGGGGATGGGGGGTGG + Intronic
1184421865 22:44386825-44386847 CTGGGGCTGTCCATGGTGGATGG - Intergenic
1184423027 22:44392774-44392796 CTGGGGCTGGGGCTGGGGGTTGG - Intergenic
1184444510 22:44539521-44539543 ATGGGTAGGTGGATGGTGGATGG + Intergenic
1184612448 22:45613397-45613419 AAGGGGAGGAGGATGGTGGACGG - Intergenic
1184746587 22:46459673-46459695 CTGGGGGTGGGGGTGCTGGTGGG - Intronic
1184995032 22:48199239-48199261 CTGGGGAAGGGGGTGGGGGAAGG + Intergenic
1185000514 22:48242680-48242702 GTGGGGATGGGGCATGTGGAGGG - Intergenic
1185079812 22:48703494-48703516 GTGGGGCTGAGGATGGGGGAGGG - Intronic
1185167314 22:49269680-49269702 CGGGGGTGGGGGATGGTGGGAGG - Intergenic
1185186750 22:49405668-49405690 CTTGGGGTGGGGATGGGGGTGGG + Intergenic
1185229276 22:49670914-49670936 CTGGGGATGGGGAGGGAGGCTGG + Intergenic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
1185394418 22:50579393-50579415 CTGGGGATGGGAATGCTAGCTGG - Intronic
1185411155 22:50683754-50683776 GTGGAGAGGGGGGTGGTGGAGGG + Intergenic
1185411169 22:50683782-50683804 GTGGAGAGGGGGGTGGTGGAGGG + Intergenic
1185411175 22:50683795-50683817 TGGTGGAGGGGGATGGTGGAGGG + Intergenic
1203259031 22_KI270733v1_random:162351-162373 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
949395303 3:3608476-3608498 CTGGGGAGGGGGATGGTTTCAGG - Intergenic
949414508 3:3800269-3800291 CCGGGGACGGGGAGGGAGGAGGG + Intronic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949514921 3:4798920-4798942 CTGGGGGTAGGGATGGGGCAAGG + Intronic
949775693 3:7630189-7630211 CTGGGGATGGTGATGGTGGTGGG + Intronic
950061103 3:10071671-10071693 CTGGGGAGGGTAATGGTGGTTGG + Intronic
950107537 3:10397774-10397796 CTGCAGGTGGGGATGTTGGAGGG - Intronic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950194824 3:11001595-11001617 CAGGGGCAGGGGATGGTTGATGG + Intronic
950302118 3:11889556-11889578 CTGGGGAGGGTAATGGTGGTTGG + Intergenic
950329322 3:12143989-12144011 CTGGGGCTGGAGGTGGTGGGCGG + Intronic
950345309 3:12287825-12287847 CTGGGGGTGGGGGTGGGGGTGGG - Intronic
950625735 3:14245345-14245367 CTGGGGACGGGGGTGGAGGAGGG - Intergenic
950629101 3:14269777-14269799 CTAGGGATAGGGTTGGGGGAAGG - Intergenic
950633941 3:14302253-14302275 CTGGGAATGGGCATGGTGAGAGG - Intergenic
950652132 3:14413703-14413725 CCGGGGGTGGGGCTGGGGGAAGG + Intronic
950793596 3:15493202-15493224 CTGGGGAGGTGGCTGATGGAAGG + Intronic
950890850 3:16402418-16402440 CTGGGGAGGGGGGTTGTTGAGGG - Intronic
950969014 3:17167967-17167989 CTGCGGATGGGGAAGCTGCAGGG + Intronic
951204273 3:19909548-19909570 CTGGGGGTGGGGTAGGTGGTGGG + Intronic
951368858 3:21818180-21818202 ATGGGGGTGGGGATGGGGGAGGG + Intronic
951459957 3:22940801-22940823 CTGGGGAGGGGGATGGTTTGGGG - Intergenic
951527710 3:23669812-23669834 CTGGGCATGGGGCTGGAGCAGGG - Intergenic
951580931 3:24161819-24161841 GTGGGGGTGGGGGTGGGGGAGGG - Intronic
951604155 3:24413708-24413730 GTGGGGTCGGGGATGGGGGAGGG - Intronic
951696282 3:25448884-25448906 CTGGGGATTGCGGGGGTGGAGGG - Intronic
952043232 3:29285237-29285259 GTGGGGGTGGGGGTGGTGGTGGG + Intronic
952120485 3:30237475-30237497 GTGGAGATGGGGATGGTTAATGG - Intergenic
952460621 3:33521883-33521905 AAGGGGCTGGGGCTGGTGGAGGG - Intronic
952494637 3:33905018-33905040 ATGGGGCTGGGGAGGGTGGCAGG + Intergenic
952534323 3:34294340-34294362 CTTGGTATGTGGATGGTGGATGG + Intergenic
952816339 3:37451261-37451283 CTGGGGGTGGGGATGGGGGTAGG + Intergenic
952833558 3:37585422-37585444 CTTGGGAGAGGGATGGTGGTTGG - Intronic
952835463 3:37598356-37598378 CTGGGGGAGGGGATGGTGCCAGG + Intronic
952882723 3:37994750-37994772 CAGGGGATGGGGGTGTTGGAGGG - Intronic
953064355 3:39455728-39455750 CTGGAGATGGAGATGGAGGGTGG + Intergenic
953139883 3:40219476-40219498 GTGGGGTGGGGGATGGGGGAGGG - Intronic
953222897 3:40989551-40989573 CTGGGGCTGGGGTTGCTGAAAGG - Intergenic
953228656 3:41044066-41044088 GTGGGGATGGGGATTGTGACAGG - Intergenic
953390777 3:42532484-42532506 CTGGAGCAGGGGATGGTGGTGGG - Intronic
953699914 3:45187522-45187544 GTGGGCATGGGCATGGTGCAGGG + Intergenic
953857579 3:46511842-46511864 CTGGGGGTGGGTTTGGTGGGCGG - Intergenic
953885552 3:46712708-46712730 CTGGGAATGGGGATGGCTGTTGG - Intronic
953978304 3:47399227-47399249 CTGGTGCTGGGGGTGGGGGATGG + Intronic
954317195 3:49807529-49807551 TTGGGGGTGGGGATGGCTGACGG + Intronic
954334768 3:49909772-49909794 CTGGGGGAGGGGGTGGAGGAGGG + Intronic
954381328 3:50220736-50220758 CTGAGGGTGGGGCTGGTGTAGGG + Exonic
954461363 3:50628845-50628867 CTGGGGCTTGGGAAGGTGAAAGG + Intronic
954472190 3:50707604-50707626 GTGGGGATGGGGATGTCAGATGG + Intronic
954519617 3:51213069-51213091 CTAGGAATGGGGAGGGAGGAGGG - Intronic
954584297 3:51720462-51720484 CTTGGGATGGGGAAGCTGGCGGG - Intergenic
954672840 3:52299763-52299785 TTCGGGAAGGGGATGGTTGATGG + Intergenic
954749152 3:52804010-52804032 GTGGGGATAGGGATGGAGGCCGG + Intronic
954750347 3:52810056-52810078 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
954757715 3:52850684-52850706 CTGCAGATGGGGATGGGCGAAGG - Intronic
954902544 3:54032129-54032151 CTGGGGCAAGGGATGATGGATGG + Intergenic
955032545 3:55234804-55234826 CTCAGGAGGGGGATGGTGGGAGG - Intergenic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955350402 3:58189270-58189292 CTGGGGGTGGGGTGGGTGAAGGG - Intergenic
955408317 3:58639781-58639803 GTTGGGATGGAGATGGAGGAGGG + Intronic
955750752 3:62183811-62183833 GTGGGGATGGGGAAGGATGAAGG + Intronic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
955933056 3:64077163-64077185 ATGGGGATGGGGATGGGGATGGG + Intergenic
955933059 3:64077169-64077191 ATGGGGATGGGGATGGGGATGGG + Intergenic
955933062 3:64077175-64077197 ATGGGGATGGGGATGGGGATGGG + Intergenic
955933065 3:64077181-64077203 ATGGGGATGGGGATGGGGATGGG + Intergenic
955947057 3:64205493-64205515 CTGGGGACAGGGTTGGTGGCAGG + Intronic
956126410 3:66015026-66015048 CTGGGTGAGGGGATGGTGGTGGG - Intronic
956411760 3:68986653-68986675 CTGGGGATGTGGATGGATGGGGG - Intronic
956539621 3:70321249-70321271 CTGGGAATGGGGATGGAGGGAGG - Intergenic
956701796 3:71965286-71965308 GTGGGGAGGGGGCTGGAGGATGG + Intergenic
956718280 3:72097412-72097434 CTGGGGATGGGGGTGGGGAGTGG + Intergenic
956861299 3:73326656-73326678 CTGGGGAGGGGGATGGCAGAGGG - Intergenic
956891353 3:73617184-73617206 CTGGGGATGGGGTGGCTGCAAGG + Intronic
957094727 3:75768174-75768196 CTTTAGATGGGGTTGGTGGAAGG - Intronic
957721974 3:84013600-84013622 CTGGGGTCGGGGATGGGGAAGGG + Intergenic
958147605 3:89646664-89646686 TTGGGGCAGGGGATGGAGGATGG - Intergenic
958733992 3:97988931-97988953 GTGGGGATGGTGGTGGTGGTAGG + Intronic
959068448 3:101680605-101680627 CTGGGAGTGTGGAAGGTGGAAGG - Intergenic
959459184 3:106604037-106604059 CTGGGGATGTGGGTGCTGGTTGG + Intergenic
959583239 3:108003117-108003139 CTGGGGATGGAGACGCAGGAGGG - Intergenic
960158753 3:114325988-114326010 CTGGGGTTGGGGCAGGTGCAGGG + Intergenic
960325010 3:116285165-116285187 ATGGGGATGGGGAAGTTGAAGGG - Intronic
960593845 3:119390711-119390733 CTGTGGATGGGGAATCTGGATGG + Intronic
960734621 3:120765024-120765046 TTGGGGATGGGGAGGGTGGGGGG - Intronic
961143115 3:124572214-124572236 CTGGGGGTGGAGGTGGGGGAAGG + Intronic
961378690 3:126483259-126483281 CTGGGTGTGGGGATGGGGGCCGG - Intronic
961426008 3:126848650-126848672 CTGGGGGTGGAGAAGGTAGAGGG + Intronic
961738162 3:129015237-129015259 GTAGGCTTGGGGATGGTGGAGGG - Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
961810845 3:129520928-129520950 GTGGGGCTGGGGAAGGTGGATGG - Intergenic
961925207 3:130472157-130472179 CAGGGAATGGGGAAGTTGGAGGG + Intronic
962290825 3:134134978-134135000 CTGGGCATGGAGCTGGGGGAGGG - Intronic
962886221 3:139630383-139630405 CTGGGACTTGGGAGGGTGGAAGG + Intronic
962980955 3:140489553-140489575 CTGGGCCTGGGGGTAGTGGAAGG + Intronic
963088024 3:141456236-141456258 CTGTGGATGGGGCTGGGGTAGGG - Intergenic
963333157 3:143938934-143938956 CAGGGGATGGGGATGGGGAAGGG + Intergenic
963734047 3:148999846-148999868 CTGACTATGGGGGTGGTGGAGGG - Intronic
963758491 3:149259978-149260000 CTGGGGATGGGGATGCCAGATGG - Intergenic
963853050 3:150226773-150226795 GTGGGGGTGGGGGTGGGGGATGG - Intergenic
963853053 3:150226779-150226801 CTGGGGGTGGGGGTGGGGGTGGG - Intergenic
964542646 3:157796718-157796740 CTGTGGGTGAGTATGGTGGAAGG - Intergenic
964995554 3:162874779-162874801 CTCAGGATGGGGGTGGTGGATGG - Intergenic
965271637 3:166623421-166623443 CTGGGGGTGGGGGTGGGGGAGGG + Intergenic
965343578 3:167519633-167519655 CAGGGGTGGGGGATGGGGGAGGG + Intronic
965499460 3:169440539-169440561 TTGGGGATGGGGTGGGAGGAGGG + Intronic
965528599 3:169747825-169747847 CAGGGAATAGGGGTGGTGGAGGG - Intergenic
965530930 3:169769274-169769296 CTGGGGCTGGGGAGGGTGGGTGG - Intronic
965620562 3:170638699-170638721 CTGGGGTGGGAGATGGAGGATGG - Intronic
965704925 3:171496599-171496621 CTGGTGCTGGGGGTGGTGAAGGG + Intergenic
965821059 3:172684973-172684995 TTGGGGATGGGAGTGGGGGATGG - Intronic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
965925729 3:173977319-173977341 ATGGGAGTGGGGATGGGGGAAGG + Intronic
966294342 3:178401712-178401734 CAGAGGATGGGGCTGCTGGAGGG + Intergenic
966874843 3:184315823-184315845 CGGGGGATGGGGCGGGTGGGGGG - Exonic
967042660 3:185707821-185707843 TTGAGGAGAGGGATGGTGGAAGG - Intronic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
967157307 3:186705382-186705404 TTGGGGATGGGGATAGGGGAAGG - Intergenic
967557673 3:190877306-190877328 CAGGGGATGGGGATGGCGACAGG + Intronic
967597870 3:191349078-191349100 CTGCTGATGGGGGTGGAGGAGGG + Intronic
967705020 3:192640063-192640085 CACGGGATGGGAATGGGGGAAGG + Intronic
967872876 3:194246734-194246756 CTGGTGATGGTGATGGTGGAGGG - Intergenic
968264262 3:197350497-197350519 CAGGGGCTGGGGAGGGAGGAAGG - Intergenic
968267659 3:197375209-197375231 GTGGGGATGGGGAGAGAGGATGG - Intergenic
968357769 3:198122079-198122101 CTGGGGGTGGGGGTGGGGGTGGG - Intergenic
968479551 4:827138-827160 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
968533037 4:1105318-1105340 CTGGGGATGTGGTGGGTGGCTGG - Intronic
968816636 4:2824893-2824915 CTGGGCATGGGGATGGAGCTGGG - Intronic
969030122 4:4205146-4205168 CAGGGGATGGTGAGGATGGAAGG - Intronic
969186331 4:5477488-5477510 CTGGGGATCCGGATGCTGGTGGG - Intronic
969263267 4:6046895-6046917 CTGGGGCAGGGGGTGTTGGAGGG - Intronic
969289506 4:6229725-6229747 GTTGGGATGGGGATGGAGGCTGG - Intergenic
969328060 4:6455413-6455435 CTGGGGGTGCAGATGGTGGCAGG - Intronic
969423371 4:7109817-7109839 CCGGGGATGGGGGTGGGGGCAGG + Intergenic
969425972 4:7124035-7124057 TTGGAGATGGGGATGGAGTACGG - Intergenic
969509721 4:7610838-7610860 CTGTGGACGGGGATGGGGAAGGG + Intronic
969522171 4:7684817-7684839 CTGGGGCTGGTGGTGGTGGTGGG - Intronic
969554174 4:7894891-7894913 CCAGGGAGGGGGATGCTGGAAGG + Intronic
969703816 4:8781550-8781572 TTGTGGATGGGGCTGGCGGAAGG - Intergenic
969848585 4:9938907-9938929 CTGGGGGTGGGGATGGAGTGGGG + Intronic
969894507 4:10290848-10290870 GTGGGGGTGGGGGTGGTGCAGGG + Intergenic
970027341 4:11637338-11637360 GTGGGGAAGGTGCTGGTGGAAGG - Intergenic
970096364 4:12467296-12467318 TTGGGGAGGGGGATGGTTGTCGG + Intergenic
970317645 4:14845041-14845063 GTGGGGATGGGGATGGGAGTGGG + Intergenic
970317654 4:14845059-14845081 GTGGGGATGGGGATGGGGATGGG + Intergenic
970317656 4:14845065-14845087 ATGGGGATGGGGATGGGAGTGGG + Intergenic
970317665 4:14845083-14845105 GTGGGGATGGGGATGGGGATGGG + Intergenic
970317667 4:14845089-14845111 ATGGGGATGGGGATGGGAGTGGG + Intergenic
970317681 4:14845119-14845141 ATGGGGATGGGGATGGGGATGGG + Intergenic
970317684 4:14845125-14845147 ATGGGGATGGGGATGGGGATGGG + Intergenic
970317687 4:14845131-14845153 ATGGGGATGGGGATGGGGATGGG + Intergenic
970317690 4:14845137-14845159 ATGGGGATGGGGATGGGGATGGG + Intergenic
970317693 4:14845143-14845165 ATGGGGATGGGGATGGGGATGGG + Intergenic
970317696 4:14845149-14845171 ATGGGGATGGGGATGGGGATGGG + Intergenic
970441331 4:16083338-16083360 CTGGGGATGGGGGCGGGGGTGGG - Intronic
971141409 4:23928973-23928995 CAGGGGATGCGGTTGGGGGAGGG + Intergenic
971248629 4:24952833-24952855 CAGGGGATGGGGAAGATGGGGGG - Intronic
971310384 4:25521096-25521118 CTGGGGATGCGCGCGGTGGATGG + Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972568962 4:40293841-40293863 CTGGGCGTGGTGATGCTGGATGG + Intergenic
973333249 4:48930950-48930972 CTGGGGAAGGGGATCGGGGCAGG + Intergenic
973545241 4:51974293-51974315 CTGGGGAATGGGATGGTTGTAGG - Intergenic
973728036 4:53795471-53795493 CGGGGGATGGGGTGGGGGGAGGG + Intronic
973926881 4:55747877-55747899 CTGGGGATGGGGAGTATGGAAGG + Intergenic
973931153 4:55793926-55793948 CTGGGGATGGGGAAGAGGGACGG + Intergenic
974064599 4:57065951-57065973 CTGGGGCTGGAGATGGGGGTAGG - Intronic
974287370 4:59886302-59886324 GTGGGGGTGGGGGTGGGGGAAGG - Intergenic
974931613 4:68366622-68366644 CTGGTGAAGGGGATGGTAAAAGG - Intergenic
975134670 4:70863075-70863097 CTTGGGGTGGGGGTGGTTGAGGG - Intergenic
975232699 4:71953543-71953565 ATGGGGTTGGGGGAGGTGGAAGG + Intergenic
975360226 4:73460955-73460977 GGGGGGAGGGGGATGGGGGAGGG - Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
976100788 4:81561050-81561072 TTGGGGGTGGGGTTGGGGGAGGG - Intronic
976111091 4:81674545-81674567 CTGGGGGTGGGGGTGGGGGTGGG + Intronic
976269071 4:83212435-83212457 GTGTGGGTGGGGGTGGTGGAGGG + Intergenic
976388388 4:84484540-84484562 CTGGGGGAGGGGGTGGGGGAAGG - Intergenic
976451330 4:85194603-85194625 GTGGGGTTGGGGAAGGGGGAGGG + Intergenic
976865079 4:89715295-89715317 ATGGGGTGGGGGATGGGGGAGGG + Intergenic
977140063 4:93359539-93359561 CTAGAGATGGGGATGGTTAATGG - Intronic
977799214 4:101205659-101205681 CAGAGGATGGGGATGGTAGGTGG - Intronic
977922385 4:102659906-102659928 CTGGGGATGGAGAGGGTAGCTGG - Intronic
978325331 4:107547487-107547509 CGGGGGGTGGGGGTGGGGGAGGG - Intergenic
978810612 4:112845580-112845602 CTGGGGTTGGGGAAGTTGAATGG + Intronic
978913683 4:114097074-114097096 CTCAGAATGGGGAAGGTGGAAGG - Intergenic
979198374 4:117946664-117946686 GTGGGGTGGGGGATGGGGGAGGG + Intergenic
979335958 4:119463140-119463162 GTGGGGTGGGGGATGGAGGAGGG - Intergenic
979677330 4:123424262-123424284 TTGGGGATGGAGATGATGGGTGG + Intergenic
980094382 4:128474433-128474455 TTTGGGATGGGGATGGTGAAGGG + Intergenic
980749679 4:137071831-137071853 CTAGGAGTGGGGATGGGGGAAGG - Intergenic
981089667 4:140719853-140719875 CTGGAGTTGGGTTTGGTGGAAGG + Intronic
981348136 4:143699444-143699466 CTGGAGCTGGAGGTGGTGGACGG - Exonic
981578571 4:146229954-146229976 CTGGGGATAGGTAAGCTGGACGG - Intergenic
981631081 4:146818933-146818955 GTGGGGTGGGGGATGGGGGAGGG + Intronic
982091673 4:151884877-151884899 CTGGAGGTGGGGGTGGTAGAGGG + Intergenic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
982598198 4:157412715-157412737 TTGGGGGTGGGGCTGGTGGGAGG - Intergenic
982826663 4:160010981-160011003 CTGGGGATGGAGCAGGTGGTTGG + Intergenic
983571020 4:169208193-169208215 GTGGGGGTGGGGATGAAGGAGGG - Intronic
983586603 4:169362323-169362345 GTGGGGGTGGGGGTGGTTGAGGG + Intergenic
983905223 4:173174609-173174631 GGGAGGATGGGGATGGGGGAGGG - Intronic
984562237 4:181284284-181284306 ATGGAGATGGGGGTGCTGGATGG - Intergenic
984624188 4:181987254-181987276 CAGGGGCTTGGGATGATGGAAGG - Intergenic
985280570 4:188282653-188282675 CCGGGGATAGGGAAGGAGGAAGG - Intergenic
985397351 4:189558016-189558038 ATTTGGGTGGGGATGGTGGAAGG - Intergenic
985404999 4:189629047-189629069 CAGGGGAGAGGGATGGGGGAAGG + Intergenic
985514606 5:335034-335056 CTGGGGACTGGGATGCTGGGTGG + Intronic
985549309 5:524989-525011 CTGGGGTGGGGGATGCTGGCTGG - Intergenic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986125897 5:4882222-4882244 CAGGGGCTGGGGGTTGTGGAAGG - Intergenic
986282274 5:6333404-6333426 CTGGGGATCTGGATGGTGGCAGG + Intergenic
986310025 5:6544785-6544807 CTGAGGGTGGGGACGGTGGGGGG - Intergenic
986435767 5:7728821-7728843 CTGGGGATGGGGAGAGTGACTGG + Intronic
986536387 5:8792434-8792456 TTGGAGATGGGGCTGATGGAAGG + Intergenic
986616116 5:9619020-9619042 CTTGGGAAGAGGATGGTAGATGG - Intergenic
986639713 5:9860369-9860391 CTGGGGAGGGAGATGAGGGAAGG - Intergenic
986734506 5:10658956-10658978 CTAAGGATGGGGGTGGTGGGTGG + Intergenic
987314576 5:16712115-16712137 GTGGGGGTGGGGATGGGGAAGGG + Intronic
987616776 5:20284092-20284114 CAGGGGCTGGGGATGGTAGCGGG + Intronic
987775028 5:22354347-22354369 GTGGTGATGGCGATGGTTGATGG - Intronic
988364471 5:30278122-30278144 GTGGGGATGGGGGTAGAGGAGGG + Intergenic
988404531 5:30807168-30807190 CTGGGGATCAGGATGTTGGCTGG - Intergenic
988662926 5:33293308-33293330 CTGCTGATGGTGGTGGTGGAGGG - Intergenic
988994156 5:36698289-36698311 AGGGTGATGGGGATGGTAGAGGG - Intergenic
989027728 5:37086623-37086645 GTGGGGAGGGGAATGGAGGAAGG + Intergenic
989550215 5:42726336-42726358 CTGGGGATGGGAAGTGGGGAAGG - Intergenic
989578442 5:43010303-43010325 GTGAGGGTGGGGATGTTGGAGGG - Intergenic
989651735 5:43697712-43697734 ATGTGGATGGTGATGGTGGAAGG + Intronic
990192831 5:53279831-53279853 TGGGGGGTGGGGATGGGGGAGGG - Intergenic
990287213 5:54311662-54311684 CTGAGGGTGGGGATGGGGGGGGG - Intergenic
990461791 5:56037556-56037578 CTGAGGATGAGGTTGGGGGAGGG + Intergenic
990553084 5:56903810-56903832 GTGGAGATGGAGAGGGTGGATGG - Intergenic
990609696 5:57444844-57444866 CATGGCATGGGGATGGTGGGAGG - Intergenic
990662308 5:58029771-58029793 CTGGAGATGGGGAAGCTGTATGG + Intergenic
991054634 5:62306951-62306973 ACGGGGATGGGGATGGGGGTGGG + Intronic
991144398 5:63283832-63283854 GTGGGGACGGGGAGGGTGGAGGG + Intergenic
991424869 5:66480339-66480361 ATGGGGTGGGGGATGGGGGAGGG - Intergenic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
991703869 5:69339441-69339463 TTGGGGTTGGGGGAGGTGGAAGG + Intergenic
992004627 5:72465363-72465385 CTGGGGAAGGGGAGTGTTGAAGG + Intronic
992484429 5:77181092-77181114 GTGAGGGTGGGGATGGTGGTGGG - Intergenic
992626964 5:78645089-78645111 CTGGGGCTGGGGGTGGTAGCAGG - Intronic
992652412 5:78872665-78872687 GTGGGGAGGGGGAGGGGGGAGGG + Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993901057 5:93584618-93584640 CGGGGGGTGGGGAGGGGGGAAGG + Exonic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
994176396 5:96716518-96716540 CCGGGGATGGGGATGGGGATGGG + Intronic
994221139 5:97196603-97196625 GGGGAGATGGGGATGGGGGAAGG - Intergenic
994475000 5:100256538-100256560 CTGGGGAGGGGGTGGGTGGGTGG - Intergenic
994729638 5:103476723-103476745 CTGGGGAAGGGGGTGGTGGGGGG - Intergenic
995019901 5:107354563-107354585 CTGGGCATGGTGATGGGTGATGG - Intergenic
995039016 5:107567554-107567576 CTGGGGCAGGGGTGGGTGGATGG - Intronic
995139924 5:108724084-108724106 ATGGGGATGGGCATGGAGGTAGG + Intergenic
995539301 5:113169024-113169046 CTGGGGCTGGGGATTGGTGATGG - Intronic
995751072 5:115453799-115453821 CTGAGGCTGGGCAGGGTGGAAGG - Intergenic
995911776 5:117196304-117196326 CTGGGGTAGGGGTTGGGGGATGG + Intergenic
995946012 5:117646812-117646834 CTGGGGAAGGGTTGGGTGGAGGG - Intergenic
996766500 5:127039598-127039620 CTGGGGATGGGGAAGGATGGAGG + Intergenic
996808699 5:127488871-127488893 CCATGGATGGGGATGGGGGATGG + Intergenic
996819012 5:127605156-127605178 CTGGTGCTGAAGATGGTGGAAGG - Intergenic
997584420 5:135035885-135035907 ATGGGGATGGGGATGGGGGTAGG - Intronic
997584423 5:135035891-135035913 ATGGGGATGGGGATGGGGATGGG - Intronic
997584426 5:135035897-135035919 ATGGGGATGGGGATGGGGATGGG - Intronic
997584429 5:135035903-135035925 ATGGGGATGGGGATGGGGATGGG - Intronic
997584432 5:135035909-135035931 ATGGGGATGGGGATGGGGATGGG - Intronic
997584435 5:135035915-135035937 CGGGGGATGGGGATGGGGATGGG - Intronic
997613019 5:135228329-135228351 CTGGGATTGGTGGTGGTGGAGGG + Intronic
997894731 5:137705842-137705864 CTTGGGATGGAGGTGCTGGATGG + Intronic
998094341 5:139388756-139388778 TCTGGGATGGGGATGGGGGATGG + Intronic
998137596 5:139682314-139682336 CTGGGGCTGGGGTTGGGGGAGGG - Intronic
998233844 5:140380790-140380812 GTGGGGGTGGGGATGGGGCAAGG + Intergenic
998822616 5:146070304-146070326 ATGGGGCTGGAGATGGAGGAGGG + Intronic
998899145 5:146833746-146833768 CTGGGGGTGGGGGAGGAGGATGG - Intronic
998940828 5:147280416-147280438 GGGGGGTTGGGGATGGGGGAGGG + Intronic
999075463 5:148791398-148791420 CTGTGGATGTGGGTGGGGGATGG - Intergenic
999159946 5:149487123-149487145 CTGGGGATGGCCAGGATGGAGGG + Intergenic
999286408 5:150396767-150396789 AAGGGGATGGGGACGGTTGAAGG + Exonic
999328418 5:150657211-150657233 CTGGGGTTGGGGATGGGTTAGGG + Intronic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999966896 5:156819833-156819855 TTGAGGATGGGCATGGAGGAAGG + Intergenic
1000040922 5:157484709-157484731 CTGGGGAAGGTGGTGGTGAAGGG - Intronic
1000829810 5:166088754-166088776 ATGGGGATGGGGATGGGTGGGGG - Intergenic
1000829814 5:166088760-166088782 GTGGGGATGGGGATGGGGATGGG - Intergenic
1000906878 5:166974929-166974951 CTGGGGAGGGGGGTGGAGGAGGG + Intergenic
1001071321 5:168587601-168587623 CTGGGCAAGTGGGTGGTGGATGG - Intergenic
1001317830 5:170656877-170656899 GTGGGGATGGGCATGGGTGAGGG - Intronic
1001430741 5:171660034-171660056 CTGGGGATGGGGGGTGGGGAAGG - Intergenic
1001562341 5:172677827-172677849 CTGGTGAGGGGGCTGATGGAGGG - Intronic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1001916835 5:175568967-175568989 CTTGGGATGGGGATTGAGGAAGG + Intergenic
1001926087 5:175638301-175638323 CTGGGCATAGGGATGGCGCATGG - Intergenic
1001933392 5:175688392-175688414 CTGGGGCAGAGGATGGTGGCTGG - Intergenic
1002055209 5:176594749-176594771 CTGGGGAGGGCGGTGGTGGCCGG + Intronic
1002061876 5:176630186-176630208 CTGGGGAAGGGGATGGAAAATGG - Intronic
1002095413 5:176828078-176828100 CTGGGGGTGGGTGTGGAGGAGGG - Intronic
1002106510 5:176881884-176881906 CCGGTGCTGGGGATGGTGGCTGG - Intronic
1002301452 5:178259622-178259644 ATGGGGATGGGGATGGGGACGGG - Intronic
1002302192 5:178263403-178263425 CTGGGGAAGGGGATGGCGTGGGG - Intronic
1002330024 5:178434748-178434770 CTGAGGCCTGGGATGGTGGAGGG + Intronic
1002418117 5:179131495-179131517 CTGGGGATGGGGATGAATGTGGG + Intronic
1002459946 5:179368379-179368401 CTGGGGATGTGGACAGAGGAGGG - Intergenic
1002466605 5:179411884-179411906 CCGGTGGTGGGGAGGGTGGAAGG - Intergenic
1002679184 5:180948097-180948119 GTGGGGATGGAGATGGGAGAAGG - Intronic
1002685057 5:181003598-181003620 GTGGGGATGGAGATGGGAGAAGG - Intronic
1002910968 6:1490800-1490822 CTGTAGATGGGGTGGGTGGAGGG - Intergenic
1003405077 6:5821312-5821334 CTGGGGATGGGGAGGAGGGAAGG - Intergenic
1003699305 6:8444565-8444587 CTGGGGTGGGGGATTGGGGAGGG - Intergenic
1003982781 6:11405075-11405097 ATGGGGAAGGGGATAGGGGAAGG + Intergenic
1004110817 6:12716959-12716981 CCGGGGATGGGGGTTGTGGGGGG + Intronic
1004136898 6:12976105-12976127 CTGGGGGAGGGGGTGATGGAAGG + Intronic
1004201745 6:13555078-13555100 CTGGGGATGGGGTTGGCGCCAGG + Intergenic
1005039531 6:21588499-21588521 CAGGGGATGGGGTAGGAGGACGG + Intergenic
1005222077 6:23598233-23598255 CTGGGGTGGGGGAGGGGGGAAGG + Intergenic
1005492782 6:26361920-26361942 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005492971 6:26363719-26363741 TTGGGGAGGGGGAAGGGGGAGGG + Intergenic
1005496947 6:26396041-26396063 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005863164 6:29916869-29916891 CTGGTGATAGGGTTAGTGGAAGG - Intergenic
1006084802 6:31587973-31587995 CTGGGGACAGGGAAGGGGGAGGG + Intronic
1006167270 6:32072272-32072294 CTGTGGCTGGGGCTGGTGGGAGG + Intronic
1006215654 6:32440287-32440309 CTGGGGGTGGGGGTGGGGGTGGG + Intronic
1006285355 6:33089080-33089102 CAGGGGATGGTGAAAGTGGAAGG + Intergenic
1006296544 6:33172471-33172493 CTGGGGATTGGGGTGCTGAAAGG - Intronic
1006303329 6:33205377-33205399 CTGGGGAGGGAGTTGGAGGAGGG + Intronic
1006830637 6:36965894-36965916 TTGGGGCTGGGGAGGTTGGAGGG - Intergenic
1006901819 6:37507732-37507754 ATGGTGATGGGGATGGGGGTAGG + Intergenic
1006912075 6:37570061-37570083 ATGGGAATGGGGATAGTGGGTGG - Intergenic
1006984156 6:38166548-38166570 GTGCGGAGGGGGAAGGTGGAGGG - Intergenic
1007110494 6:39310851-39310873 AGGGGGATGGGGGTGGGGGAAGG - Intronic
1007133166 6:39495831-39495853 ATGGGGGAGGGGATGGAGGAGGG + Intronic
1007407849 6:41645081-41645103 TTGGGGAGGGGGCAGGTGGAAGG + Intronic
1007418882 6:41707519-41707541 CAGGAGATGGGGATGGGGCAGGG - Intronic
1007423546 6:41733878-41733900 CTGGGGATGAGGTTGGAGGCTGG - Intronic
1007498019 6:42274950-42274972 CTGGGGATGGGGGTGGAAGGTGG - Intronic
1007558055 6:42782970-42782992 CTGGGGAGGGGGAGGGGAGAGGG + Intronic
1007660094 6:43478744-43478766 CTGGGGATGTGGATTTTGGTGGG + Intronic
1007732322 6:43954699-43954721 GTGGGGTGGGGGAGGGTGGAGGG - Intergenic
1007751251 6:44073310-44073332 CCGGGGTTGGGGATGCTGGGCGG - Intergenic
1008189414 6:48436589-48436611 CAGGGGATGGGGTGGGGGGAGGG - Intergenic
1008210163 6:48712257-48712279 GTGGGGTGGGGGATGGGGGAGGG + Intergenic
1008843034 6:55927739-55927761 CAGGGGATGGGGGTGGGGAAAGG - Intergenic
1008921928 6:56851364-56851386 CTGGGGAAGGGGATGGAGTGGGG - Intronic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009712038 6:67336206-67336228 TTGGGTGTGGGGATGGTGGTGGG + Intergenic
1010236620 6:73580156-73580178 CTGGGGATGGGGGTGGGGGTGGG - Intergenic
1010323203 6:74537696-74537718 CTTGGAATGGGGATTGTGGGTGG + Intergenic
1010641351 6:78331932-78331954 CTAGGGGTGGGAATGGTGGCAGG - Intergenic
1011268206 6:85548160-85548182 CTGGAGATGGGGAATGGGGATGG + Intronic
1011385382 6:86791862-86791884 CTGGTGATGGTGATGGGGGTAGG - Intergenic
1011415907 6:87120056-87120078 GTGGGGAGGGGGTTGGTGGGGGG - Intergenic
1011847384 6:91582912-91582934 CTGAGGATGGAGTTGGGGGATGG + Intergenic
1012027575 6:94017095-94017117 CTGGGGATTGGAGTGGAGGATGG - Intergenic
1012403119 6:98861215-98861237 CTGGGGGTGGGGATAGGGGTAGG + Intergenic
1012706369 6:102536986-102537008 GTGGGGTGGGGGATGGGGGAGGG + Intergenic
1013290438 6:108714769-108714791 CCGGGGGTGGGGGTGGTGGGGGG + Intergenic
1013301420 6:108808474-108808496 CTGGAGAAGGGGGTGGTGCATGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013586542 6:111583745-111583767 CTGGGGATGGGGATGGTTTGGGG - Intronic
1013743604 6:113318769-113318791 CTGGGGCTGGGGAGGAAGGAAGG - Intergenic
1013792700 6:113855194-113855216 CGGGGGCTGGGAGTGGTGGAGGG - Intergenic
1014101918 6:117520472-117520494 CTAGGGAGGAGGATGGGGGAGGG - Intronic
1015037208 6:128670132-128670154 CTGAGGGTGGTGATGGTGGATGG + Intergenic
1015277145 6:131395077-131395099 CTGGGGATGGGGCTTTTGGGGGG + Intergenic
1015480246 6:133700638-133700660 CTGGGATTGGGGAGGGTGGGAGG - Intergenic
1015800150 6:137052343-137052365 CTGGGGATAGGGCTGGGGGTGGG - Intergenic
1015999352 6:139028026-139028048 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
1016326854 6:142912773-142912795 CATGGTGTGGGGATGGTGGATGG - Intronic
1016330998 6:142951794-142951816 CTGGGGATGAGAAGGGTGCAGGG + Intergenic
1016755140 6:147676825-147676847 CTGGGGGTGGGGGTGGGGGTAGG + Intronic
1016827777 6:148404581-148404603 CTGGGGGTGGGGCAGGTGGTGGG - Intronic
1016850816 6:148617101-148617123 CAGGGGAGGGGGATGGAGAAAGG - Intergenic
1016883623 6:148936250-148936272 CTGGAGATGGGGGTGATAGAGGG + Intronic
1017061780 6:150491307-150491329 CTGGGGAGGGGAAGGGAGGAAGG - Intergenic
1017077327 6:150631315-150631337 CTGGGGAGGAGGGTGCTGGATGG - Intronic
1017255211 6:152325303-152325325 CTAGGGTTGGGGGTGGAGGACGG + Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017544673 6:155438275-155438297 CTTGGGATGGGCAAGGTGGATGG - Intronic
1017645680 6:156538114-156538136 CTGGGCATGAGGATGGGGGTTGG + Intergenic
1017718188 6:157226715-157226737 CTGGGGCTGGGGGTGGGGGTGGG - Intergenic
1017742516 6:157419455-157419477 CAGAGGATGGGGAGGGTGTATGG - Intronic
1017900565 6:158715641-158715663 CAGGGGGTGGGGGTGGTGGGGGG - Intronic
1017981520 6:159404486-159404508 GTGGAGGTGGGGATGGGGGATGG + Intergenic
1018415781 6:163601080-163601102 CTGTTGATGGGGGTGGGGGATGG - Intergenic
1018633424 6:165840075-165840097 ATGGGGATGGGGATGAAGGTGGG - Intronic
1018657392 6:166051526-166051548 CTGGGGTTAGGGATGGTGGGGGG - Intergenic
1018952564 6:168388803-168388825 CCGGGGATGGGCAGGGAGGAGGG - Intergenic
1018961035 6:168448571-168448593 CTGGGGAGGAGGATGGTGATGGG + Intronic
1019057935 6:169236346-169236368 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057942 6:169236375-169236397 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019182424 6:170198971-170198993 CTGAGAATGGGGATGGAGGCAGG + Intergenic
1019343255 7:518322-518344 CCGGGGATGGGGATGGGGATGGG + Intronic
1019343258 7:518328-518350 ATGGGGATGGGGATGGGGATGGG + Intronic
1019407973 7:893824-893846 TTGGGGCTGGGGAGGGAGGAGGG + Intronic
1019417048 7:932576-932598 CCGGGGAGGGGGATGGTCCAGGG + Intronic
1019454048 7:1115448-1115470 TTGGTGATGAGGAGGGTGGATGG - Intronic
1019525112 7:1477294-1477316 GTGGGGATGGGGTGGGTGGATGG - Intronic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1019811335 7:3167362-3167384 ATGGGGATGGGGATGGGTGTGGG - Intronic
1019811337 7:3167368-3167390 GTGGGGATGGGGATGGGGATGGG - Intronic
1019851324 7:3561073-3561095 CTAGGGGTGGGGAAGGGGGAAGG - Intronic
1020009431 7:4800175-4800197 CTGGGGATGGGCCTGATCGACGG - Exonic
1020037152 7:4971317-4971339 CCAGGGATGGGGATTATGGAGGG + Intergenic
1020132933 7:5569842-5569864 CTGGGGTGGGGGATGGGGGATGG - Intergenic
1020151937 7:5689191-5689213 CTGGGGAGGTGGATGCTTGACGG + Intronic
1020393957 7:7692206-7692228 CTGGTGGTGGTGGTGGTGGAGGG + Intronic
1020678827 7:11211547-11211569 GTGGGGATGGTGATCCTGGAGGG + Intergenic
1021058945 7:16085700-16085722 TTGGGGATGGAGATGGGGAAAGG + Intergenic
1021175008 7:17440227-17440249 CAGGGGGTGGGGGTGGGGGATGG - Intergenic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021464767 7:20929785-20929807 CTGGGGGTGGGGGAGGAGGAGGG - Intergenic
1021549796 7:21858703-21858725 CTGGGGCTGGCGATGGTGGTGGG + Intronic
1021610121 7:22449257-22449279 CAGGGGGTGGGGATGGTTAATGG - Intronic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1021677028 7:23090657-23090679 GAGGGGATGGGGAACGTGGATGG - Intergenic
1021904856 7:25323045-25323067 CTGGGGAAGGGGATAATGGAGGG + Intergenic
1022347427 7:29530010-29530032 TTGGGTAGGGGGATGGGGGAGGG - Intergenic
1022468382 7:30666432-30666454 CAGGGGTTGGGTAGGGTGGAGGG - Intronic
1022511222 7:30935880-30935902 CTGGGGAAGGGGAGGGTTGGTGG + Intergenic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1022864906 7:34407191-34407213 CTTGAGATGGGGCTGTTGGAGGG + Intergenic
1023669542 7:42561324-42561346 CTGAGGATGGAGGTGGTGGTTGG - Intergenic
1023868975 7:44252533-44252555 CAGGGGGTGGGGGTGGGGGAGGG + Intronic
1024067845 7:45756729-45756751 GTGGGGTGGGGGATGGGGGAGGG + Intergenic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024545266 7:50512523-50512545 ATGGGCCTGGGGGTGGTGGATGG - Intronic
1025018618 7:55463614-55463636 CTGGGGATGGGGATGCCAGGTGG + Intronic
1025134708 7:56401299-56401321 GTGGGGTTGGGGAAGGGGGAGGG + Intergenic
1025264956 7:57449257-57449279 CTGGGGATGGGGAGGGTAGGGGG + Intergenic
1025294870 7:57769334-57769356 CTGGGGCTGGGGCTGGTTGCAGG + Intergenic
1026136088 7:67662324-67662346 CTGAGGATGAGGGAGGTGGAGGG - Intergenic
1026308829 7:69166258-69166280 AAGGGGATGGGGAGGGGGGAAGG + Intergenic
1026467735 7:70668882-70668904 CTGGGGAGGGTGGTGGTGGCTGG + Intronic
1026481275 7:70781703-70781725 CAGGTCATGGGGGTGGTGGATGG - Exonic
1026638662 7:72105831-72105853 ATAGGGATGGGGATGAGGGAGGG + Intronic
1026995004 7:74609948-74609970 CTGGGGCTGAGGTTGGGGGAAGG - Intergenic
1027028661 7:74872917-74872939 ATGGGGATGGGGTTGGGGGTAGG - Intergenic
1027053150 7:75032215-75032237 CTGGGAGTGGGGACGGTGGGGGG + Intronic
1027236864 7:76303461-76303483 CTGGGGATGGGGCTGTGGGTGGG - Intronic
1027933188 7:84566809-84566831 CTGGGGACAGGGTTGGTAGATGG - Intergenic
1028332482 7:89611673-89611695 CTGGGGGTGGGGCTGGGGGAGGG + Intergenic
1028403395 7:90448656-90448678 GTGGGGTGGGGGATGGGGGAGGG + Intronic
1028849467 7:95520640-95520662 GTGTGGATGGGGATGGGGGGTGG - Intronic
1028963288 7:96773951-96773973 CTGGGGATGGGGAGTGGGGGTGG + Intergenic
1028983523 7:96992713-96992735 CTGGGATTGGGGGTGGTCGAGGG + Intergenic
1029113090 7:98223343-98223365 CTGGGGCTGGGGGTGGGGGTGGG - Intronic
1029148484 7:98463569-98463591 TTGGGGAGGGGGCAGGTGGAGGG + Intergenic
1029154762 7:98508247-98508269 CTGGGGGTAGAGGTGGTGGAGGG + Intergenic
1029457754 7:100679638-100679660 CTGGGGTTGGGGTGGGTGCAGGG - Exonic
1029490988 7:100869801-100869823 CTGGGGAGGGGGATGGGAGGGGG + Intronic
1029594164 7:101528056-101528078 CCGGGGATGGGGGTGGTGTGGGG + Intronic
1029851805 7:103469381-103469403 CTGGGGATGGGGATGGGGGTGGG - Intergenic
1030259752 7:107550651-107550673 CAGGTGATGGGGATGGATGAAGG - Intronic
1030295486 7:107921845-107921867 AAGGGGATGGGGGTGGGGGAGGG - Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031575580 7:123412098-123412120 CTTGGGATGGGGGTTGTGGTGGG - Intergenic
1032053449 7:128664895-128664917 TTGGGGATGGATGTGGTGGAAGG - Intergenic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032464889 7:132137907-132137929 ATGAGTATGAGGATGGTGGAAGG + Intronic
1032470112 7:132172127-132172149 CTTGGGCTGGGGAGGGTGGCAGG - Intronic
1032548338 7:132762024-132762046 TTGGGGCTGGGGATGGGGAAGGG + Intergenic
1032581195 7:133105138-133105160 CTGGGGCGGGGGTGGGTGGAGGG - Intergenic
1032616438 7:133477315-133477337 CAGGGGTTAGGGAGGGTGGAGGG - Intronic
1033005525 7:137557816-137557838 CTGTTGATGGGCATGGTGGGAGG - Intronic
1033116788 7:138632574-138632596 TGGGGGATGGAGAAGGTGGAGGG + Intronic
1033220260 7:139522981-139523003 TTGGGGCTGAGAATGGTGGAGGG + Intergenic
1033327349 7:140390630-140390652 CTGGCGGTGGGGATGGAGGTTGG - Intronic
1033343890 7:140512539-140512561 CAGGGGTGGGGGATGGTGGCAGG + Intergenic
1033513403 7:142082897-142082919 CTGGGGATTGTGAGGGTGTATGG + Intronic
1034162288 7:149002418-149002440 TTGGGGGTGGGGATGGGGGTGGG + Intergenic
1034340018 7:150346863-150346885 GTGGGGAAGGGGATGTTGGGAGG + Intergenic
1034401166 7:150862557-150862579 ATGGGGATGGGGATGGGGCAAGG + Intergenic
1034469396 7:151247509-151247531 ATGGGGATGGGGCTGGTGGCGGG - Intronic
1034469542 7:151248117-151248139 CTGGGGGTGGGGGTGGGGGATGG - Intronic
1034699523 7:153084097-153084119 CTGGAGATGGGGCTGGTGGGAGG - Intergenic
1034979649 7:155467827-155467849 CTGGGGCTGGGGCTGGAGAAGGG - Intergenic
1035021606 7:155804021-155804043 CTGGGGGTGGGGTTGGAGGAAGG - Intronic
1035032262 7:155869266-155869288 CTGGGGATGGGGGTGGGTGGTGG + Intergenic
1035289949 7:157831465-157831487 CTGGGGCTGGGGCTGGGAGACGG + Intronic
1035291842 7:157844319-157844341 CTGGGGATGGGGCTGGGGCCTGG - Intronic
1035293892 7:157857111-157857133 GTGGAGCTGGGGATGCTGGAGGG + Intronic
1035373522 7:158393857-158393879 CTGGGGAGGGAGGTGATGGAAGG - Intronic
1035479208 7:159168658-159168680 CAGGGGCTGGGGAAGGAGGAAGG + Intergenic
1035835662 8:2749169-2749191 CTGAGGCTGGGTTTGGTGGAAGG + Intergenic
1035911145 8:3567513-3567535 AGGGGGAAGGGGATGGGGGAGGG + Intronic
1036125380 8:6057422-6057444 ATGGGGGTGGTGATGGGGGATGG - Intergenic
1036257709 8:7218818-7218840 GTGGGGGTGGGGGTGGAGGATGG - Intergenic
1036309758 8:7677414-7677436 GTGGGGGTGGGGGTGGAGGATGG - Intergenic
1036359778 8:8068705-8068727 GTGGGGGTGGGGGTGGAGGATGG + Intergenic
1036775789 8:11612478-11612500 CTGGGGAGGGGGGTGGTGGGCGG - Intergenic
1036891182 8:12598265-12598287 GTGGGGGTGGGGGTGGAGGATGG - Intergenic
1037033908 8:14142699-14142721 CTGGAGATGGGCCTGGTGGGAGG + Intronic
1037121582 8:15294126-15294148 TTGGGGGTGGGGGTGGGGGAGGG + Intergenic
1037172177 8:15906062-15906084 CTGGGGGTGGGCCTGGTGGGAGG - Intergenic
1037329570 8:17730878-17730900 CTGGAGATGGATATGGAGGATGG + Intronic
1037383796 8:18316280-18316302 CGGAGGATGGGGATGGGGAAGGG - Intergenic
1037496271 8:19443877-19443899 CTGGGGGTGGGGGTGGAGGTGGG + Intronic
1037596179 8:20356220-20356242 CTGGGGAGGAGGATGTAGGAGGG - Intergenic
1037637197 8:20710715-20710737 CTGGGGGTGGGGGTGGTGGCTGG + Intergenic
1037668808 8:20996979-20997001 CTGGGGCTGGAGACGGGGGATGG - Intergenic
1037815970 8:22112013-22112035 ATGGGGATGGGGATGGGGATAGG + Intergenic
1037929213 8:22867639-22867661 CTTGGGGTGGGGTTGGAGGAGGG - Intronic
1038284697 8:26196501-26196523 CTGGAGATGGGGCGGGAGGAGGG - Intergenic
1039120862 8:34144683-34144705 TTGGGGATGGGGTAGGTGGGTGG + Intergenic
1039444538 8:37620686-37620708 CTGGGGGTGGGGAGGGTGAAGGG - Intergenic
1039450543 8:37671211-37671233 CTTGGGATGGGGGTGGAGGGAGG + Intergenic
1040108137 8:43551629-43551651 CTGGGGATGCGCTCGGTGGATGG - Intergenic
1040419061 8:47222202-47222224 CTGGGGATGGTGATGATGCTGGG - Intergenic
1040428013 8:47308634-47308656 GTGGGGGTGGGGATGGGGGTGGG + Intronic
1040428015 8:47308640-47308662 GTGGGGATGGGGGTGGGAGAGGG + Intronic
1040534540 8:48297349-48297371 CTGGGGATGGGGGTTGGGGAGGG + Intergenic
1040601780 8:48891930-48891952 ATGGGGATGGGGATGGGGACTGG - Intergenic
1040798022 8:51308390-51308412 CTGGGGAGGGGCCTGGTGGGAGG + Intergenic
1041041249 8:53848535-53848557 TTGGGGGTGGGGTTGGGGGAGGG - Intergenic
1041134991 8:54748707-54748729 CTGATACTGGGGATGGTGGATGG - Intergenic
1041244353 8:55876521-55876543 TGGGGGATGGGGATGGTGAGGGG - Intergenic
1041277864 8:56181571-56181593 CAGGGGGTGGGGGTGGGGGAGGG + Intronic
1041839035 8:62248430-62248452 CTGGGGGTTGGGAGGGTGGTCGG - Intergenic
1042164362 8:65931010-65931032 CAGGGGATGGGGATAGCTGAGGG + Intergenic
1042222079 8:66483892-66483914 GTGGGGACGGGGATGGTAGTAGG - Intronic
1042314543 8:67411603-67411625 CTGGGGATGGTGATGGAGGTGGG + Intergenic
1042611926 8:70608897-70608919 ATGGGGACGGGGATGGGGGTGGG - Intronic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1042976127 8:74471671-74471693 CTGGGGATGGGGATGGAGAAAGG - Intronic
1043479291 8:80637049-80637071 CTGGGGGTGGGGGAGGGGGACGG - Exonic
1043529943 8:81138194-81138216 TTGGGGATGGGGGTTGTTGAAGG - Intergenic
1044569068 8:93698203-93698225 ATGGGAATGGGGCTGGGGGAGGG + Intergenic
1044768509 8:95603853-95603875 TTAGGGATGGGGAGGGAGGAAGG - Intergenic
1044928212 8:97227174-97227196 CTGGGGATGGAGATGGATGATGG - Intergenic
1044973399 8:97641798-97641820 TTGGGGATGGGGGTGGAGGGTGG - Intergenic
1045295999 8:100872146-100872168 CTGGGGGTGGGGGTTGGGGAGGG - Intergenic
1045345676 8:101291438-101291460 CTGGGGATGGGGAGAGGGGTAGG + Intergenic
1046323709 8:112612933-112612955 GCGGGGAGGGGGATGGTTGAAGG + Intronic
1046544582 8:115633372-115633394 CTGGTGGTGGTGGTGGTGGAAGG + Intronic
1047416204 8:124666697-124666719 CATGGGATAGGGAGGGTGGAGGG + Intronic
1047904588 8:129459713-129459735 CTGGGGATGGGGCTGGTAGCAGG - Intergenic
1048041111 8:130729570-130729592 CTGGGGAGGGTAATGGTGGAGGG + Intergenic
1048179822 8:132184498-132184520 CTGGGGATGGGGGTGGGGAAGGG + Intronic
1048209818 8:132445446-132445468 TTGGGGATGGGGCAGGTGCATGG - Intronic
1048223348 8:132563231-132563253 CTGGGGAGAGGGATGTTGCAGGG + Intergenic
1048447904 8:134505660-134505682 CTGGCTCTGGGGATGGAGGAAGG + Intronic
1048586821 8:135781872-135781894 TTGGGGATAGGGAGGGGGGAAGG - Intergenic
1048899641 8:139025003-139025025 ATGGGGATGGGGATGGGGATGGG + Intergenic
1049049486 8:140183242-140183264 CTGGGGATGGGGATGGTTGGTGG + Intronic
1049164099 8:141116137-141116159 CTGGGGATGGAGCTGGGGGCTGG - Intergenic
1049252722 8:141597753-141597775 CTGGGGCGGGGGGTGGGGGAAGG + Intergenic
1049710857 8:144062746-144062768 GGGTGGCTGGGGATGGTGGAGGG - Intronic
1049759423 8:144325388-144325410 ATGGGGAGGGGGTTGGGGGAGGG - Intronic
1049878976 8:145049079-145049101 GTGGGAAGGGGGATGGTGCAGGG - Intergenic
1049887870 9:40364-40386 TTGGGGATGGGGATGGAAGTGGG - Intergenic
1049958666 9:716980-717002 CTGTGGGTGGGGGTGGTGGGGGG + Intronic
1050136886 9:2474786-2474808 CTGGGGGTGGGGATGGGAGGTGG + Intergenic
1050236562 9:3587271-3587293 CAGGGGAGGGAGCTGGTGGAAGG + Intergenic
1050245479 9:3685366-3685388 CAGGGGTTGGGGATGGCAGAGGG - Intergenic
1050482296 9:6099907-6099929 CTTGGAATGGGGATGTTGGGAGG + Intergenic
1050483153 9:6106850-6106872 CTGGGGCTGGGGATAGCAGAGGG + Intergenic
1050761327 9:9075552-9075574 GTGGGGTGGGGGATGGGGGAGGG - Intronic
1051201077 9:14624663-14624685 ATGGGGAAGAGGATGGTCGATGG + Intronic
1051206343 9:14693172-14693194 GTGCGGATGGGGATGGGGGTGGG + Intronic
1051238127 9:15023468-15023490 CTGAGGATGGGGGTGGGGGTTGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051585930 9:18726889-18726911 CTGGGGCTGGGGCAGGGGGAGGG - Intronic
1051698633 9:19795264-19795286 CCGGGGGTGGGGGTGGTGGGGGG - Intergenic
1052728500 9:32258852-32258874 CTGGGTATGGGGTAGGTGGGTGG - Intergenic
1053135355 9:35647227-35647249 CTGGGGATGCGGAGGAGGGAGGG - Intergenic
1053179256 9:35954111-35954133 CTGGGGATGGGGATGAAGGGTGG + Intergenic
1053233812 9:36434310-36434332 AGGGGGAGGGGGATGGGGGAAGG + Intronic
1053793000 9:41699925-41699947 CTGGGGATGGGGTTGGGGCCGGG - Intergenic
1054152175 9:61614899-61614921 CTGGGGATGGGGTTGGGGCCGGG + Intergenic
1054161545 9:61674943-61674965 CTGGGGCTGGGGCTGGTTGCAGG - Intergenic
1054172634 9:61855669-61855691 CTGGGGCTGGGGATGGGGCTGGG + Intergenic
1054172637 9:61855675-61855697 CTGGGGATGGGGCTGGGGCTGGG + Intergenic
1054447485 9:65384680-65384702 CTGGGGCTGGGGATGGGGCTGGG + Intergenic
1054447488 9:65384686-65384708 CTGGGGATGGGGCTGGGGCTGGG + Intergenic
1054471949 9:65546043-65546065 CTGGGGATGGGGTTGGGGCCGGG + Intergenic
1054664903 9:67725126-67725148 CTGGGGATGGGGCTGGGGCTGGG - Intergenic
1054664906 9:67725132-67725154 CTGGGGCTGGGGATGGGGCTGGG - Intergenic
1054696468 9:68364637-68364659 CTGGGGATGGGGATTCAGAAAGG - Intronic
1055185291 9:73444556-73444578 CTGGGGATTGAGAAGGTGTATGG + Intergenic
1055469307 9:76595389-76595411 CTGGGGGTGGGGGTGGGGGTGGG + Intergenic
1055773948 9:79747807-79747829 CTAGGGATGGGGAGGAAGGAGGG - Intergenic
1056182985 9:84103442-84103464 CTGGGGAGGGGGAGGGAGGCAGG + Intergenic
1056516457 9:87355838-87355860 CTGGAAATGGGGATGGGAGAAGG - Intergenic
1056735022 9:89201994-89202016 TTGGGGTTGGAGAGGGTGGATGG - Intergenic
1056879828 9:90380517-90380539 CTGGGGGTGGGGAAGTTGGAAGG - Intergenic
1056897695 9:90566357-90566379 TTGGGGGTGGTGATGGGGGAGGG - Intergenic
1057106712 9:92426122-92426144 CAAGGGATGGGGATGGGGGGAGG + Intronic
1057177662 9:93011395-93011417 CTGGGGATGGGGGTGGAAGGAGG - Intronic
1057181996 9:93035350-93035372 CTGGGGAGAGGGATGGTGCGGGG - Exonic
1057220134 9:93253101-93253123 ATGGGGATGGGGAAGGGGGTGGG - Intronic
1057817138 9:98304125-98304147 CGTGGGATGGGGATGAAGGAAGG + Intronic
1057974468 9:99590014-99590036 CTGGGGATGGGGGTGGGGTAGGG + Intergenic
1057987025 9:99727345-99727367 CTGGGGGTAAGGATGGGGGATGG + Intergenic
1058051446 9:100410911-100410933 CTAGGGATGGGGACTGTCGAAGG - Intergenic
1058424249 9:104862734-104862756 CTGGGGGTGGGGGTGGGGGTGGG - Intronic
1058609335 9:106757767-106757789 CTGGGGGTGGTGGTGGTGGGGGG + Intergenic
1058682064 9:107448749-107448771 ATTGGGATGGGGTTGGTAGATGG - Intergenic
1058840516 9:108903218-108903240 GTGGGGTGGGGGAGGGTGGAGGG - Intronic
1058875157 9:109237787-109237809 CTGGTAGTGGTGATGGTGGAGGG + Intronic
1059322355 9:113479599-113479621 CTGGGGCTGGGGTTGGGGGATGG + Intronic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059360681 9:113739785-113739807 CTGGGATTGGAGTTGGTGGAGGG - Intergenic
1059714919 9:116904937-116904959 TTGGGGGTGCGGAGGGTGGAAGG - Intronic
1059874910 9:118623670-118623692 CTAGGGTTGGGGATGGGGGAAGG + Intergenic
1060203845 9:121670077-121670099 CAGGGGTTAGGGATGGTGGTGGG - Intronic
1060389443 9:123267010-123267032 TTGGGGAGGAGGAAGGTGGAGGG - Intronic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060527441 9:124328474-124328496 CTGGGGAAGCGGATGCTGGTGGG - Intronic
1060773772 9:126353055-126353077 CTGGAGATGAGGATTGTGGCTGG + Intronic
1060794289 9:126503928-126503950 CTGGGGAGGAGGACGGTTGACGG + Exonic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1061000408 9:127899389-127899411 CCGGGGATGGGGATGGATGCGGG - Intronic
1061008934 9:127943937-127943959 CTGGGGATGTGGATGTTAGGCGG + Intronic
1061048071 9:128178130-128178152 TTGGGGATGGGCAGGCTGGAAGG + Intronic
1061222326 9:129259303-129259325 ATGGGGATGGGGCTGGGAGAAGG - Intergenic
1061222327 9:129259309-129259331 CTGGCGATGGGGATGGGGCTGGG - Intergenic
1061238863 9:129357789-129357811 CTGGGGAGGAGGGTGGTGGCAGG - Intergenic
1061255688 9:129453438-129453460 GAGGAGATGGGGATGGGGGATGG + Intergenic
1061320121 9:129823486-129823508 CTGGGGCTGGGGCTGGGGGATGG - Intronic
1061320203 9:129823694-129823716 CTGGGGCTGGGGCTGGGGGATGG - Intronic
1061320263 9:129823855-129823877 CTGGGGCTGGGGCTGGGCGATGG - Intronic
1061360411 9:130138436-130138458 GAGGGGATGGGGAAGGGGGAAGG - Exonic
1061493646 9:130959655-130959677 CTAGGGATGATGATGGTGAATGG + Intergenic
1061657488 9:132104238-132104260 CTGGGGAGGGTGAGGGTAGAGGG - Intergenic
1061670370 9:132185074-132185096 CTGGGGGTGGGGAGGCTAGAGGG + Intronic
1061818105 9:133208082-133208104 CTGGGGTTGGCGGTGGGGGAGGG + Intronic
1061893133 9:133633294-133633316 GTGGGGATGGGAATGGGGGTGGG - Intergenic
1061940252 9:133880155-133880177 GTGGGCAAGGGGCTGGTGGAGGG - Intronic
1062215299 9:135385890-135385912 GTGGGCACGGGGAGGGTGGAGGG - Intergenic
1062249900 9:135588748-135588770 CTGGGGCTGGGGCTGGTGGGGGG + Intergenic
1062254278 9:135613819-135613841 CCGGGTGTGGGGAGGGTGGAGGG - Intergenic
1062324440 9:136005401-136005423 CTGGGGCTGGGCTTGGTGGTGGG + Intergenic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062372752 9:136248557-136248579 CTGGGCCTGGGGGTGGTGGCGGG + Intergenic
1062498736 9:136843432-136843454 CTGGGGGTGGGCAGGGCGGAGGG - Intronic
1062622371 9:137428736-137428758 CTGGGTGGGGGGATGGGGGAGGG + Intronic
1062628289 9:137452737-137452759 TAGAGGATGGGGATGATGGAGGG + Exonic
1203744842 Un_GL000218v1:35982-36004 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1203475222 Un_GL000220v1:144360-144382 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1203707786 Un_KI270742v1:68399-68421 CTGGGGATGCGGACAGAGGAGGG - Intergenic
1203565262 Un_KI270744v1:83502-83524 CTGGGGATTGGGAGAGTGGCCGG + Intergenic
1203654532 Un_KI270752v1:10101-10123 CTGGGGCTGGGGCGGGTGGGGGG + Intergenic
1203663322 Un_KI270754v1:3272-3294 ATTTGGGTGGGGATGGTGGAAGG + Intergenic
1185871150 X:3665924-3665946 ATGGGGATGGGGATGGGGATGGG + Intronic
1186083713 X:5962928-5962950 CTGGGGGTGGGGGTGGGGGGGGG - Intronic
1186309475 X:8302150-8302172 CTCTGGAAGGGCATGGTGGATGG + Intergenic
1186389820 X:9147937-9147959 CTGTGGCTGGGGGTGGGGGAGGG - Intronic
1186506589 X:10098306-10098328 CTGGGGAGGGGGGAGGGGGAAGG - Intronic
1186739559 X:12503196-12503218 CTGGGGATAGAGATGGGGGTTGG + Intronic
1186822133 X:13300313-13300335 CAGGGGATTGGGATGGGGGTGGG - Intergenic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1187043017 X:15616845-15616867 GTGGGAGTGGGCATGGTGGAGGG - Intergenic
1187279529 X:17847316-17847338 TGGGGGATGGGGACGGTGGAGGG - Intronic
1187346907 X:18473841-18473863 CTGGGGGTGGGGAGAGGGGATGG + Intronic
1187391122 X:18887208-18887230 GTGGGACTGGGGCTGGTGGAGGG + Intergenic
1187709228 X:22037362-22037384 ATGGGGAGAGGGATGGTGGGAGG - Intronic
1187746126 X:22411317-22411339 CGGGAGATGGGGATCGTGGGGGG - Intergenic
1187862396 X:23694781-23694803 GTGGGGATGGGGGTGGGGGCGGG + Intergenic
1188816850 X:34726126-34726148 TGGGGGATGGGGTTGGGGGAGGG - Intergenic
1189106636 X:38243336-38243358 CTGGGGGAGGGGATGGAGAAGGG + Intronic
1189129308 X:38481700-38481722 CAAGGGATGGGGGTGGAGGAAGG - Intronic
1189198109 X:39168470-39168492 TGGGGGATGAGGATGATGGATGG + Intergenic
1189251092 X:39601203-39601225 CTGGGGTTGGGGTGGGAGGAGGG - Intergenic
1189254326 X:39626050-39626072 CTGGGGAGGGGGCTGGAGAAAGG - Intergenic
1190123710 X:47684864-47684886 GTGGGGGTGGGGGTGGGGGAAGG + Intergenic
1190176238 X:48152579-48152601 CAGGGGTTGGGGATGGTGGATGG + Intergenic
1190186904 X:48243294-48243316 CAGGGGTTAGGGATGGTGGATGG + Intronic
1190195050 X:48310082-48310104 CAGGGGTTAGGGATGGTGGATGG - Intergenic
1190202850 X:48378914-48378936 CAGGGGTTAGGGATGGTGGACGG + Intergenic
1190207688 X:48416499-48416521 CAGGGGTTAGGGATGGTGGACGG - Intergenic
1190210807 X:48445857-48445879 CAGGGATTAGGGATGGTGGATGG + Intergenic
1190304113 X:49072770-49072792 CTGGAGATAGGGCTGGTGGGAGG - Intronic
1190530903 X:51375020-51375042 ATGGGGGTGGGGATGGTTTATGG + Intergenic
1190661482 X:52658305-52658327 CAGGGGTTAGGGATGGTGGATGG - Intronic
1190669126 X:52723572-52723594 CAGGGGTTAGGGATGGCGGATGG - Intergenic
1190670291 X:52734832-52734854 CAGGGGTTAGGGATGGCGGATGG + Intergenic
1191077514 X:56470792-56470814 CTGGGGATGGTGGTGGTGTTGGG - Intergenic
1191152586 X:57235994-57236016 CTGGGGATGGGAGTGGAGAATGG - Intergenic
1191872301 X:65758460-65758482 CAGAGGATGGGGAATGTGGATGG + Intergenic
1191900442 X:66034759-66034781 TTGGGGATGGGGGTGGGGGTGGG + Intronic
1192013238 X:67298817-67298839 GTGGGGTTGGGGATGGGGGAGGG - Intergenic
1192221235 X:69198703-69198725 CTGAGGTTGGGAATGGTGGAGGG - Intergenic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1192330062 X:70168018-70168040 GTGGGGATGGGGATGGTTAATGG + Intergenic
1192451256 X:71246452-71246474 CTGGGGGTGGTGGGGGTGGAGGG + Exonic
1192565465 X:72159736-72159758 GGGGGGATGGGGGTAGTGGACGG - Intergenic
1192677665 X:73215238-73215260 CTGGGGAGGGGAGAGGTGGATGG + Intergenic
1192951932 X:76026425-76026447 CTGGAGCTGGGGAGGCTGGACGG + Intergenic
1193425750 X:81338451-81338473 CTGGGGGTGGGGGTGGGGGTGGG + Intergenic
1193526650 X:82598611-82598633 CTGGTGAGTGGGATGGGGGAAGG - Intergenic
1193765342 X:85521895-85521917 CTGGGGAAGGGTCTGGTGGGAGG + Intergenic
1193977986 X:88147387-88147409 CTGGGCATGTGGATGGGGCAGGG - Intergenic
1194445873 X:93986702-93986724 CTGGAGCAGGGGATGCTGGATGG + Intergenic
1194558549 X:95393105-95393127 CTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1194833679 X:98656757-98656779 AGGGGGATTGAGATGGTGGAGGG + Intergenic
1195068463 X:101258167-101258189 CTGGGGGTGGGGATGGGGGTGGG + Intronic
1195108861 X:101625107-101625129 CTGGGGATGTGGATGATGCTGGG + Exonic
1195309829 X:103621394-103621416 CTAGGGTTGGGGAGGATGGAGGG + Intronic
1195315565 X:103674534-103674556 GTGGGGAGGGGGGTGGAGGAGGG - Intergenic
1195347238 X:103962823-103962845 CTGGGGTTGGGGCTGGTGCTTGG + Exonic
1195360204 X:104076018-104076040 CTGGGGTTGGGGCTGGTGCTTGG - Intergenic
1195363563 X:104107085-104107107 GTGGGGATGTGGATGGAGCAGGG - Intronic
1195421968 X:104685619-104685641 CTGGGGTGGGGGAAGGGGGAAGG + Intronic
1195442482 X:104914707-104914729 GTGGGGTGGGGGATGGGGGAGGG - Intronic
1195507769 X:105678469-105678491 GGGGGGATGGGGATGGTTAATGG - Intronic
1195668918 X:107452903-107452925 CTGGAGATGGGGGTGGGGGTGGG + Intergenic
1195700809 X:107704273-107704295 CAGGGGAGGGTGCTGGTGGAAGG + Intergenic
1195705621 X:107736097-107736119 AAGGGGATGGTGATGGTGGCTGG - Intronic
1195811427 X:108835909-108835931 CTGGAAATGGAGATAGTGGATGG - Intergenic
1195942781 X:110179280-110179302 GTGGGGATGGACATGGTGGTAGG - Intronic
1196237448 X:113299785-113299807 CAGGGGATGGGGAGGGGAGAGGG - Intergenic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1196362067 X:114873935-114873957 CTGGGGCTGGGGTTGGGGGTTGG - Intronic
1196417704 X:115489673-115489695 CAGGGGAGGGGCATGGTGGGAGG + Intergenic
1196708367 X:118737244-118737266 ATGGGGTTGGGGATGAAGGATGG + Intronic
1196841579 X:119864295-119864317 TTGGGGGGGGGGTTGGTGGAGGG + Intergenic
1198322598 X:135533544-135533566 CTGTGAATGGGGGTGGGGGAAGG - Intronic
1198473655 X:136974405-136974427 TGGGGGATGGGGTTGGGGGAGGG + Intergenic
1199086748 X:143636233-143636255 CTGGGGAAGGGGGTGGTAGTTGG + Intergenic
1199363939 X:146956542-146956564 GTGGGCATGGGGATGATTGATGG - Intergenic
1199408425 X:147490845-147490867 GTGGGGTGGGGGTTGGTGGAGGG - Intergenic
1199474485 X:148230913-148230935 AGGGGGATGGGGAGGGGGGAGGG - Intergenic
1199525826 X:148790685-148790707 TTGGGGGTGGGGTTGGGGGAGGG + Intronic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic
1199716092 X:150508346-150508368 GTGGGGGTGGGGATGGGGGGTGG - Intronic
1199825742 X:151497922-151497944 TTGGGGAAGAGGATGGGGGAGGG - Intergenic
1199834277 X:151573106-151573128 CTGGGGGTGGGATTGGGGGAAGG + Intronic
1199895097 X:152119869-152119891 ATGAGGGTGGGGATGGGGGAGGG + Intergenic
1199947258 X:152679615-152679637 ATGGGAATGGGAATGGAGGAGGG - Intergenic
1199949894 X:152699163-152699185 GTGGGGATGGGAATGGGGAATGG - Intronic
1199951364 X:152708678-152708700 TTGGGGAAGAGGATGGAGGAGGG + Intergenic
1199954011 X:152727902-152727924 TTGGGGAAGAGGATGGAGGAGGG + Intronic
1199954702 X:152734147-152734169 TGGGGGATGGGAATGGTGGTGGG - Intronic
1199958319 X:152759783-152759805 TTGGGGAAGAGGATGGAGGAGGG - Intergenic
1199959780 X:152769298-152769320 GTGGGGATGGGAATGGGGAATGG + Intronic
1199962422 X:152788839-152788861 ATGGGAATGGGAATGGAGGAGGG + Intergenic
1200000402 X:153056864-153056886 CTGGGGGTGGGGGTGGGGGTGGG + Intronic
1200074930 X:153546170-153546192 CTGGGGGTGGGGCTGGTGGAGGG + Intronic
1200102370 X:153694465-153694487 CTGGGCTGGGGGATGGTGGCGGG + Intronic
1200135816 X:153874056-153874078 CTGGGGAGGGAGATGGTGACAGG + Intronic
1200182771 X:154160973-154160995 CAGGGGCTGGGGGTGGGGGATGG + Intergenic
1200188425 X:154198087-154198109 CAGGGGCTGGGGGTGGGGGATGG + Intergenic
1200194075 X:154235227-154235249 CAGGGGCTGGGGGTGGGGGATGG + Intergenic
1200199830 X:154273031-154273053 CAGGGGCTGGGGGTGGGGGATGG + Intronic
1200746768 Y:6910479-6910501 CTGGAGCTGGGGCTGGTGGGAGG + Intergenic
1201067800 Y:10115740-10115762 ATGGAGATGGGCCTGGTGGAAGG + Intergenic
1201158180 Y:11151025-11151047 CTGGGGATTGGGAGAGTGGCCGG - Intergenic