ID: 1183025824

View in Genome Browser
Species Human (GRCh38)
Location 22:35065435-35065457
Sequence AGAGGGACTCACCCTGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183025824_1183025827 1 Left 1183025824 22:35065435-35065457 CCTCTCTCAGGGTGAGTCCCTCT No data
Right 1183025827 22:35065459-35065481 TCTCCTGACTCACTCTTCTCAGG No data
1183025824_1183025830 7 Left 1183025824 22:35065435-35065457 CCTCTCTCAGGGTGAGTCCCTCT No data
Right 1183025830 22:35065465-35065487 GACTCACTCTTCTCAGGGAGTGG No data
1183025824_1183025828 2 Left 1183025824 22:35065435-35065457 CCTCTCTCAGGGTGAGTCCCTCT No data
Right 1183025828 22:35065460-35065482 CTCCTGACTCACTCTTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183025824 Original CRISPR AGAGGGACTCACCCTGAGAG AGG (reversed) Intergenic
No off target data available for this crispr